Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230079962:

Variant ID: vg0230079962 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30079962
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, C: 0.26, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAAGTACTAAAGTTACAAATGTAACTAAGGCACAAATCGACTGTAACTGCACTGTAATTAGTGAATGATTGCACTGTAAGTGGTGTAAGTGGAGACAA[C/G]
AACTAGAAAAAAAAGGGCCTACATCTACACTTATAATTTTCTGTATGATGCTGCCAGGTATACATGCTTTCTAATATTTTTCCAACACATTTTGCAGGAC

Reverse complement sequence

GTCCTGCAAAATGTGTTGGAAAAATATTAGAAAGCATGTATACCTGGCAGCATCATACAGAAAATTATAAGTGTAGATGTAGGCCCTTTTTTTTCTAGTT[G/C]
TTGTCTCCACTTACACCACTTACAGTGCAATCATTCACTAATTACAGTGCAGTTACAGTCGATTTGTGCCTTAGTTACATTTGTAACTTTAGTACTTCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	41.30%	8.65%	1.78%	NA
All Indica	2759	17.70%	66.60%	12.65%	3.01%	NA
All Japonica	1512	91.20%	5.50%	3.31%	0.00%	NA
Aus	269	95.50%	2.60%	1.86%	0.00%	NA
Indica I	595	7.20%	74.60%	13.78%	4.37%	NA
Indica II	465	7.50%	78.70%	11.83%	1.94%	NA
Indica III	913	25.80%	59.60%	11.72%	2.85%	NA
Indica Intermediate	786	22.30%	61.60%	13.36%	2.80%	NA
Temperate Japonica	767	83.20%	10.60%	6.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	70.00%	24.40%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230079962	C -> G	LOC_Os02g49210.1	downstream_gene_variant ; 1629.0bp to feature; MODIFIER	silent_mutation	Average:12.298; most accessible tissue: Callus, score: 23.637	N	N	N	N
vg0230079962	C -> G	LOC_Os02g49200.1	intron_variant ; MODIFIER	silent_mutation	Average:12.298; most accessible tissue: Callus, score: 23.637	N	N	N	N
vg0230079962	C -> DEL	N	N	silent_mutation	Average:12.298; most accessible tissue: Callus, score: 23.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230079962	NA	1.28E-16	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	4.82E-06	NA	mr1004_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	6.47E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	4.71E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	1.87E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	1.95E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	1.46E-23	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230079962	NA	1.34E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251