Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229675574:

Variant ID: vg0229675574 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29675574
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAAGGTATTTCAATGTAGATTATGAAGAGCATCAATGCTGTTTGATAATGTATCCTAGGACACACACTACATCATTGAGTGCTCTTTCACCACATTG[G/C]
GAAGCTTTGCATCGATTTGGCCAGAATCAACCCAACATATTGCAATTTGCAAGAGAGTCAAATAGATGGGCAGGCAGGCAAGACGCCACAGCCCACATGG

Reverse complement sequence

CCATGTGGGCTGTGGCGTCTTGCCTGCCTGCCCATCTATTTGACTCTCTTGCAAATTGCAATATGTTGGGTTGATTCTGGCCAAATCGATGCAAAGCTTC[C/G]
CAATGTGGTGAAAGAGCACTCAATGATGTAGTGTGTGTCCTAGGATACATTATCAAACAGCATTGATGCTCTTCATAATCTACATTGAAATACCTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.90%	1.90%	0.15%	0.00%	NA
All Indica	2759	96.40%	3.30%	0.25%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	86.20%	12.90%	0.86%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.40%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229675574	G -> C	LOC_Os02g48470.1	upstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:90.82; most accessible tissue: Minghui63 young leaf, score: 96.408	N	N	N	N
vg0229675574	G -> C	LOC_Os02g48480.1	upstream_gene_variant ; 2247.0bp to feature; MODIFIER	silent_mutation	Average:90.82; most accessible tissue: Minghui63 young leaf, score: 96.408	N	N	N	N
vg0229675574	G -> C	LOC_Os02g48460.1	downstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:90.82; most accessible tissue: Minghui63 young leaf, score: 96.408	N	N	N	N
vg0229675574	G -> C	LOC_Os02g48460-LOC_Os02g48470	intergenic_region ; MODIFIER	silent_mutation	Average:90.82; most accessible tissue: Minghui63 young leaf, score: 96.408	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0229675574	G	C	-0.08	-0.05	-0.02	-0.02	-0.06	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229675574	NA	2.61E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	7.10E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	2.01E-18	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	2.25E-16	mr1769	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	4.90E-10	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	1.05E-14	mr1951	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	1.49E-07	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	3.12E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	3.67E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	3.19E-15	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	2.91E-16	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	5.03E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229675574	NA	2.24E-11	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251