Variant ID: vg0229534325 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 29534325 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 77. )
AACTTGGAAAATTTGTCCACGACTACCATGATTGTGTCATATTTGCCTGACTTAGGCAGTCCCTCTATGAAGTCCATACTGACAGTCATCCAAGCTTGCA[T/C]
AGGGACTGGCAATGGTTGCAACAGACCTGGAGACTTGCAGTGTTCAACTTTGGCCTGCTGACAAGTAGTACACTGAGCAACATATTGCTGCACATCCTTT
AAAGGATGTGCAGCAATATGTTGCTCAGTGTACTACTTGTCAGCAGGCCAAAGTTGAACACTGCAAGTCTCCAGGTCTGTTGCAACCATTGCCAGTCCCT[A/G]
TGCAAGCTTGGATGACTGTCAGTATGGACTTCATAGAGGGACTGCCTAAGTCAGGCAAATATGACACAATCATGGTAGTCGTGGACAAATTTTCCAAGTT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 31.40% | 8.50% | 1.25% | 58.89% | NA |
All Indica | 2759 | 4.30% | 1.10% | 1.41% | 93.19% | NA |
All Japonica | 1512 | 81.20% | 16.00% | 1.12% | 1.72% | NA |
Aus | 269 | 35.30% | 6.30% | 0.74% | 57.62% | NA |
Indica I | 595 | 2.40% | 0.00% | 0.67% | 96.97% | NA |
Indica II | 465 | 4.70% | 0.20% | 1.72% | 93.33% | NA |
Indica III | 913 | 1.90% | 1.10% | 1.53% | 95.51% | NA |
Indica Intermediate | 786 | 8.40% | 2.40% | 1.65% | 87.53% | NA |
Temperate Japonica | 767 | 96.70% | 1.30% | 1.30% | 0.65% | NA |
Tropical Japonica | 504 | 53.60% | 42.10% | 1.19% | 3.17% | NA |
Japonica Intermediate | 241 | 89.20% | 8.30% | 0.41% | 2.07% | NA |
VI/Aromatic | 96 | 8.30% | 89.60% | 0.00% | 2.08% | NA |
Intermediate | 90 | 38.90% | 27.80% | 1.11% | 32.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0229534325 | T -> DEL | LOC_Os02g48240.1 | N | frameshift_variant | Average:11.924; most accessible tissue: Callus, score: 74.859 | N | N | N | N |
vg0229534325 | T -> C | LOC_Os02g48240.1 | missense_variant ; p.Met127Val; MODERATE | nonsynonymous_codon ; M127V | Average:11.924; most accessible tissue: Callus, score: 74.859 | benign ![]() |
-0.458 ![]() |
TOLERATED | 0.28 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0229534325 | NA | 1.02E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 5.11E-11 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 1.86E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 2.28E-12 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 1.57E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 4.69E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 1.47E-13 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | 4.86E-06 | 1.33E-15 | mr1178_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0229534325 | NA | 2.44E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |