Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229180325:

Variant ID: vg0229180325 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29180325
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCTGAATCGGCCGCGGAGGCTATTGCCTTGGTGGCGTTTGCTGGACTGGTTACACAACTTGTTGCTGGATTGGTTGTATGACCCGCTGAATCGGGAGT[A/G]
TCTGTTGAATCGGCTGCTGCTGTATTGGATCAACAGTAGGTTGAGGCGGCAGAAACATGGCAGCAACCTGATCTTGCGTCGGCCGATTCACAACCTGCCC

Reverse complement sequence

GGGCAGGTTGTGAATCGGCCGACGCAAGATCAGGTTGCTGCCATGTTTCTGCCGCCTCAACCTACTGTTGATCCAATACAGCAGCAGCCGATTCAACAGA[T/C]
ACTCCCGATTCAGCGGGTCATACAACCAATCCAGCAACAAGTTGTGTAACCAGTCCAGCAAACGCCACCAAGGCAATAGCCTCCGCGGCCGATTCAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.40%	14.00%	6.73%	44.88%	NA
All Indica	2759	11.30%	2.00%	11.05%	75.64%	NA
All Japonica	1512	60.40%	38.80%	0.46%	0.26%	NA
Aus	269	95.50%	0.40%	1.49%	2.60%	NA
Indica I	595	1.80%	2.20%	8.24%	87.73%	NA
Indica II	465	4.10%	3.90%	6.24%	85.81%	NA
Indica III	913	17.20%	0.40%	14.57%	67.80%	NA
Indica Intermediate	786	15.90%	2.50%	11.96%	69.59%	NA
Temperate Japonica	767	30.40%	68.60%	0.91%	0.13%	NA
Tropical Japonica	504	98.40%	1.00%	0.00%	0.60%	NA
Japonica Intermediate	241	76.80%	23.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	53.30%	20.00%	2.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229180325	A -> G	LOC_Os02g47730.1	missense_variant ; p.Ile334Thr; MODERATE	nonsynonymous_codon ; I334T	Average:12.056; most accessible tissue: Callus, score: 33.061	unknown	unknown	TOLERATED	1.00
vg0229180325	A -> DEL	LOC_Os02g47730.1	N	frameshift_variant	Average:12.056; most accessible tissue: Callus, score: 33.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229180325	NA	8.78E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229180325	NA	4.13E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229180325	NA	7.04E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	6.92E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	3.01E-06	mr1217	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	9.88E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	1.02E-06	1.02E-06	mr1845	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	6.57E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	8.40E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	4.49E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	1.41E-08	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	9.07E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	5.41E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	6.43E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	6.34E-08	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	5.43E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	2.67E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229180325	NA	3.56E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251