Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228545798:

Variant ID: vg0228545798 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28545798
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATTACATAATCTGTCAGTAAACCGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGTAAATGTTTATTGTAGCACCACATTGTCAAATCAT[A/G]
GAGCAATTAGACTTAAAAAATTCGTCTCACAAATTAGTCGTAATCTGTGCAATTAGTTTTTTTAGACTATATTTAATAATACTTCATGCAGATGTTCAAA

Reverse complement sequence

TTTGAACATCTGCATGAAGTATTATTAAATATAGTCTAAAAAAACTAATTGCACAGATTACGACTAATTTGTGAGACGAATTTTTTAAGTCTAATTGCTC[T/C]
ATGATTTGACAATGTGGTGCTACAATAAACATTTACTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTACTGACAGATTATGTAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	38.00%	0.66%	0.28%	NA
All Indica	2759	90.10%	8.80%	0.65%	0.47%	NA
All Japonica	1512	20.80%	78.50%	0.66%	0.00%	NA
Aus	269	17.10%	82.90%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.00%	0.17%	NA
Indica II	465	93.30%	5.40%	0.65%	0.65%	NA
Indica III	913	87.00%	11.90%	0.55%	0.55%	NA
Indica Intermediate	786	85.10%	13.10%	1.27%	0.51%	NA
Temperate Japonica	767	12.60%	87.20%	0.13%	0.00%	NA
Tropical Japonica	504	38.10%	60.50%	1.39%	0.00%	NA
Japonica Intermediate	241	10.80%	88.40%	0.83%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	52.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228545798	A -> G	LOC_Os02g46730.1	downstream_gene_variant ; 2774.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46750.1	downstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46750.2	downstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46750.3	downstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46750.5	downstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46750.4	downstream_gene_variant ; 2553.0bp to feature; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> G	LOC_Os02g46740.1	intron_variant ; MODIFIER	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0228545798	A -> DEL	N	N	silent_mutation	Average:65.077; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228545798	NA	1.37E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	7.61E-16	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	5.82E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	1.89E-14	mr1228_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	1.37E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	9.09E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	3.26E-26	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	8.67E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	1.47E-21	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	3.23E-16	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	5.34E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	7.35E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	2.42E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	5.94E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	9.16E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	8.05E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228545798	NA	4.56E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251