Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228543492:

Variant ID: vg0228543492 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28543492
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCCACTCAAGAGTTAAAAAAAAAAGAGCCTACTCAAGAGTTAAAACAAAAAGATTTGGAGGGAGAGACATCCCTCCAAACACTTTTTAGGAAGAAATT[G/A]
TGAGCGTATTAAAGATTGAACATGAGACCTCGAAATTGAAACCACACACTTCTTACCATTGCACTATCAAGTGCATCTCATGACCCATTCAAAAGTTGGA

Reverse complement sequence

TCCAACTTTTGAATGGGTCATGAGATGCACTTGATAGTGCAATGGTAAGAAGTGTGTGGTTTCAATTTCGAGGTCTCATGTTCAATCTTTAATACGCTCA[C/T]
AATTTCTTCCTAAAAAGTGTTTGGAGGGATGTCTCTCCCTCCAAATCTTTTTGTTTTAACTCTTGAGTAGGCTCTTTTTTTTTTAACTCTTGAGTGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	5.90%	0.28%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.14%	0.00%	NA
All Japonica	1512	84.90%	14.50%	0.60%	0.00%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.30%	0.13%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	60.70%	38.10%	1.19%	0.00%	NA
Japonica Intermediate	241	92.10%	6.60%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228543492	G -> A	LOC_Os02g46740.1	upstream_gene_variant ; 1682.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46730.1	downstream_gene_variant ; 468.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46750.1	downstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46750.2	downstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46750.3	downstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46750.5	downstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46750.4	downstream_gene_variant ; 4859.0bp to feature; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N
vg0228543492	G -> A	LOC_Os02g46730-LOC_Os02g46740	intergenic_region ; MODIFIER	silent_mutation	Average:52.254; most accessible tissue: Callus, score: 79.469	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228543492	NA	8.04E-11	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.08E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.43E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	6.73E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	4.12E-12	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.20E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.98E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.44E-11	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.17E-12	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	9.05E-06	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	7.06E-13	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.21E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.10E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.18E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.67E-17	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.33E-14	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	7.08E-07	NA	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.50E-11	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	1.99E-06	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.31E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	7.13E-06	NA	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	6.06E-16	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.19E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.35E-07	mr1408_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.28E-15	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.66E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	7.44E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.47E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	1.27E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.83E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.86E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	6.04E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	3.42E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	4.29E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.29E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	4.62E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	9.26E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	5.37E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	6.02E-12	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228543492	NA	2.49E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251