Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228497476:

Variant ID: vg0228497476 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28497476
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AACGATCTACTACTGCCCGCAACGCCTTCAATGCCCCTCACCAACCCTAATAACTTCCCGGCGCCGCCCCGCCCTATCTACTCACCCGACCGTCCTACGT[T/G]
TGCTTCCCTGTCTACCGGCCGTCGTTAATCCTCTCCTCTCCGATCGCTTCTCAGTTTGGGATTTTCTTTTTCCCCTTTCGCTTCACGTGAACGGCCGGCA

Reverse complement sequence

TGCCGGCCGTTCACGTGAAGCGAAAGGGGAAAAAGAAAATCCCAAACTGAGAAGCGATCGGAGAGGAGAGGATTAACGACGGCCGGTAGACAGGGAAGCA[A/C]
ACGTAGGACGGTCGGGTGAGTAGATAGGGCGGGGCGGCGCCGGGAAGTTATTAGGGTTGGTGAGGGGCATTGAAGGCGTTGCGGGCAGTAGTAGATCGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	38.60%	0.59%	0.00%	NA
All Indica	2759	90.20%	9.10%	0.76%	0.00%	NA
All Japonica	1512	19.70%	80.00%	0.26%	0.00%	NA
Aus	269	17.50%	82.50%	0.00%	0.00%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	93.50%	6.00%	0.43%	0.00%	NA
Indica III	913	87.00%	12.40%	0.66%	0.00%	NA
Indica Intermediate	786	85.40%	13.20%	1.40%	0.00%	NA
Temperate Japonica	767	9.80%	89.80%	0.39%	0.00%	NA
Tropical Japonica	504	39.50%	60.30%	0.20%	0.00%	NA
Japonica Intermediate	241	10.00%	90.00%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	45.60%	52.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228497476	T -> G	LOC_Os02g46680.1	intron_variant ; MODIFIER	silent_mutation	Average:87.102; most accessible tissue: Zhenshan97 flower, score: 96.107	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0228497476	T	G	-0.05	-0.01	-0.01	0.01	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228497476	NA	1.58E-15	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	9.39E-14	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	3.70E-06	NA	mr1241_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	2.18E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	1.91E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	9.07E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	5.23E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	1.24E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	1.11E-23	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	9.04E-16	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	4.20E-16	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	1.21E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228497476	NA	3.26E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251