Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227802642:

Variant ID: vg0227802642 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27802642
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGACAAGTTTGGAATATTAGTGATTTTTACCTCTCTTGCACTTCGATGTGAAATAAATCAGGGCTTCACAAGCACTTGCTATGGTAAACTGGTACCGA[C/T]
TGGTATGTCCTAGTGGTATAGTCTGCACTGATGTGTATGCATGTTTCGTACACAACTGCATATTGACACGAGCTCTACAGAGAACCATGGTTTCGAGCGA

Reverse complement sequence

TCGCTCGAAACCATGGTTCTCTGTAGAGCTCGTGTCAATATGCAGTTGTGTACGAAACATGCATACACATCAGTGCAGACTATACCACTAGGACATACCA[G/A]
TCGGTACCAGTTTACCATAGCAAGTGCTTGTGAAGCCCTGATTTATTTCACATCGAAGTGCAAGAGAGGTAAAAATCACTAATATTCCAAACTTGTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	9.70%	0.25%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	87.20%	12.20%	0.60%	0.00%	NA
Aus	269	47.20%	51.70%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	68.80%	29.80%	1.39%	0.00%	NA
Japonica Intermediate	241	89.60%	9.50%	0.83%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227802642	C -> T	LOC_Os02g45700.1	downstream_gene_variant ; 756.0bp to feature; MODIFIER	silent_mutation	Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N
vg0227802642	C -> T	LOC_Os02g45710.1	downstream_gene_variant ; 4410.0bp to feature; MODIFIER	silent_mutation	Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N
vg0227802642	C -> T	LOC_Os02g45700.2	downstream_gene_variant ; 756.0bp to feature; MODIFIER	silent_mutation	Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N
vg0227802642	C -> T	LOC_Os02g45690.1	intron_variant ; MODIFIER	silent_mutation	Average:68.499; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227802642	NA	9.24E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	8.87E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	1.35E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	6.23E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	3.51E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	1.44E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	6.63E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	4.83E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	1.11E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	1.37E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	1.95E-06	1.18E-09	mr1653_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227802642	NA	3.66E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251