Variant ID: vg0227635783 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 27635783 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
CTTATTGATTGATGTTGTGCTTAACTGTTCATTTTCTTATCTCAGGTTAAATTCCACGGTGAAATTGCTAGGCAATACATGTTGTTAGTACATACTCCCT[C/T]
CGTTTCACAATGTAAGTCACATTAACATCAATATGAATATGAGAAATGCTAGAATGACTTACATTGTGAAACGGAGGAAGTACTACTTTTTGCCTTTCAG
CTGAAAGGCAAAAAGTAGTACTTCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCTCATATTCATATTGATGTTAATGTGACTTACATTGTGAAACG[G/A]
AGGGAGTATGTACTAACAACATGTATTGCCTAGCAATTTCACCGTGGAATTTAACCTGAGATAAGAAAATGAACAGTTAAGCACAACATCAATCAATAAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 2.90% | 0.23% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.50% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 91.50% | 7.90% | 0.60% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 79.80% | 18.70% | 1.59% | 0.00% | NA |
Japonica Intermediate | 241 | 92.90% | 6.60% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0227635783 | C -> T | LOC_Os02g45420-LOC_Os02g45440 | intergenic_region ; MODIFIER | silent_mutation | Average:52.196; most accessible tissue: Callus, score: 77.752 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0227635783 | 9.48E-07 | 9.48E-07 | mr1085 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 9.83E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | 4.77E-06 | 1.47E-07 | mr1155 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 2.29E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 5.97E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 1.29E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 3.23E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 1.47E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0227635783 | NA | 5.52E-06 | mr1790 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |