Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227395695:

Variant ID: vg0227395695 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27395695
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATAGTAATTGCTAGTGAGTGAAGATGTGGCATGCTTGCATGGGATTTTAAATGGGTTAGAACAGTAATTGCTAGTGAGTGATGATGTGGCATGCTTG[T/C]
ATGTTGAGCTTTAGCTTCTAATAATTATTAGTGGGTACCAACTATATAGAAAGTATAGATTGTTTCACCTGCTTCCTATTTGAATGACCTCCAATAATTA

Reverse complement sequence

TAATTATTGGAGGTCATTCAAATAGGAAGCAGGTGAAACAATCTATACTTTCTATATAGTTGGTACCCACTAATAATTATTAGAAGCTAAAGCTCAACAT[A/G]
CAAGCATGCCACATCATCACTCACTAGCAATTACTGTTCTAACCCATTTAAAATCCCATGCAAGCATGCCACATCTTCACTCACTAGCAATTACTATTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	10.80%	1.04%	0.00%	NA
All Indica	2759	98.80%	1.10%	0.07%	0.00%	NA
All Japonica	1512	66.10%	30.80%	3.11%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	42.90%	52.40%	4.69%	0.00%	NA
Tropical Japonica	504	96.60%	2.80%	0.60%	0.00%	NA
Japonica Intermediate	241	75.90%	20.70%	3.32%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227395695	T -> C	LOC_Os02g45160.1	upstream_gene_variant ; 1507.0bp to feature; MODIFIER	silent_mutation	Average:41.19; most accessible tissue: Callus, score: 73.182	N	N	N	N
vg0227395695	T -> C	LOC_Os02g45160-LOC_Os02g45170	intergenic_region ; MODIFIER	silent_mutation	Average:41.19; most accessible tissue: Callus, score: 73.182	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227395695	NA	2.74E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	9.78E-08	5.12E-24	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	9.53E-06	1.84E-12	mr1163	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	5.64E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	1.45E-14	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	2.46E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	5.38E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	8.96E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	1.98E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	7.73E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	5.50E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	4.35E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227395695	NA	4.36E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251