Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0227378385:

Variant ID: vg0227378385 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 27378385
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

AAGACAATAAAAATCACTAAAATTTTAAACTTTTTAAAATTTTTACATCATGCTGGATGTTATGGTTGCTTTTGCTTGCCAAACTATAAATTGTCATAAT[G/A]
GAAAATTAAACTAAAGTTATACAACTAAGTAATAATTATAATAATAAGATATTTATTATGAACCCTATAAATATTTACGTACAAGAAAACAAAGCCAGAA

Reverse complement sequence

TTCTGGCTTTGTTTTCTTGTACGTAAATATTTATAGGGTTCATAATAAATATCTTATTATTATAATTATTACTTAGTTGTATAACTTTAGTTTAATTTTC[C/T]
ATTATGACAATTTATAGTTTGGCAAGCAAAAGCAACCATAACATCCAGCATGATGTAAAAATTTTAAAAAGTTTAAAATTTTAGTGATTTTTATTGTCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	36.60%	0.13%	0.04%	NA
All Indica	2759	97.40%	2.40%	0.18%	0.07%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	98.20%	1.70%	0.17%	0.00%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	4.70%	0.38%	0.25%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0227378385	G -> A	LOC_Os02g45130.1	upstream_gene_variant ; 1622.0bp to feature; MODIFIER	silent_mutation	Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0227378385	G -> A	LOC_Os02g45130.2	upstream_gene_variant ; 3562.0bp to feature; MODIFIER	silent_mutation	Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0227378385	G -> A	LOC_Os02g45140.1	intron_variant ; MODIFIER	silent_mutation	Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0227378385	G -> DEL	N	N	silent_mutation	Average:39.535; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0227378385	NA	5.35E-27	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	NA	8.44E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	NA	3.42E-28	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	NA	4.80E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	NA	2.99E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	9.20E-07	9.20E-07	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0227378385	NA	7.21E-33	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251