Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0226903454:

Variant ID: vg0226903454 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 26903454
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.22, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTACTAGATAGGTGCCGTACTATCAAGAGGGGTCTATGAAGCTAGCATGTGGATGATTTTGTACCATATTAGTTCATATGCATATAGGTTCATTTTGT[G/A]
GGCTTGTCTAGCCAAGTGTGGTGAGTTTTATCAAGTCCCAAACAAAGAGAGATGTGGGCACATCCTATAGGTTTGGGTAGCCTCATGTGGTTATGTCCGG

Reverse complement sequence

CCGGACATAACCACATGAGGCTACCCAAACCTATAGGATGTGCCCACATCTCTCTTTGTTTGGGACTTGATAAAACTCACCACACTTGGCTAGACAAGCC[C/T]
ACAAAATGAACCTATATGCATATGAACTAATATGGTACAAAATCATCCACATGCTAGCTTCATAGACCCCTCTTGATAGTACGGCACCTATCTAGTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	38.80%	0.19%	0.00%	NA
All Indica	2759	93.20%	6.50%	0.29%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	96.60%	2.90%	0.50%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	88.90%	11.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.10%	6.40%	0.51%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0226903454	G -> A	LOC_Os02g44410.1	upstream_gene_variant ; 4202.0bp to feature; MODIFIER	silent_mutation	Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg0226903454	G -> A	LOC_Os02g44440.1	upstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg0226903454	G -> A	LOC_Os02g44420.1	downstream_gene_variant ; 2604.0bp to feature; MODIFIER	silent_mutation	Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg0226903454	G -> A	LOC_Os02g44430.1	intron_variant ; MODIFIER	silent_mutation	Average:26.053; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0226903454	NA	2.45E-27	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	8.62E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	4.87E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	1.56E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	7.21E-08	mr1220	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	1.62E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	2.15E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	5.43E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	8.43E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	6.10E-31	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	7.62E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0226903454	NA	3.67E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251