Search for Variation information by Variation ID:
Detailed information for vg0226828976:
| Variant ID: vg0226828976 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 26828976 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TGGTAGTTGACCTTAACTTTCAGCTCATGTGGAGAGAGGCCATTTAGAGTTATCGTGTTAAGAAAGTCCAAAGGGTAGTTATTTTGGGAATCATCATCAA[C/T]
AGAATCAAAGCTATGGTAAATCTTTTCCTCGCCAAGAAACCTGTCGATCATCTTCCTGTTCAGCTTATCCACGAAATCATTTTCTGTTGAGAGAATGGCC
Reverse complement sequence
GGCCATTCTCTCAACAGAAAATGATTTCGTGGATAAGCTGAACAGGAAGATGATCGACAGGTTTCTTGGCGAGGAAAAGATTTACCATAGCTTTGATTCT[G/A]
TTGATGATGATTCCCAAAATAACTACCCTTTGGACTTTCTTAACACGATAACTCTAAATGGCCTCTCTCCACATGAGCTGAAAGTTAAGGTCAACTACCA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 3.00% | 20.55% | 37.79% | NA |
| All Indica | 2759 | 11.60% | 0.10% | 26.02% | 62.23% | NA |
| All Japonica | 1512 | 89.00% | 8.80% | 1.85% | 0.40% | NA |
| Aus | 269 | 5.60% | 0.00% | 78.81% | 15.61% | NA |
| Indica I | 595 | 5.00% | 0.00% | 13.45% | 81.51% | NA |
| Indica II | 465 | 7.50% | 0.20% | 31.83% | 60.43% | NA |
| Indica III | 913 | 19.30% | 0.00% | 32.75% | 47.97% | NA |
| Indica Intermediate | 786 | 10.10% | 0.40% | 24.30% | 65.27% | NA |
| Temperate Japonica | 767 | 93.20% | 4.60% | 1.96% | 0.26% | NA |
| Tropical Japonica | 504 | 95.80% | 2.40% | 0.99% | 0.79% | NA |
| Japonica Intermediate | 241 | 61.00% | 35.70% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 3.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 1.10% | 10.00% | 23.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0226828976 | C -> T | LOC_Os02g44350.1 | missense_variant ; p.Val98Ile; MODERATE | nonsynonymous_codon ; V98I | Average:16.611; most accessible tissue: Callus, score: 29.071 | benign  |
0.119 |
TOLERATED | 0.75 |
| vg0226828976 | C -> DEL | LOC_Os02g44350.1 | N | frameshift_variant | Average:16.611; most accessible tissue: Callus, score: 29.071 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0226828976 | NA | 1.31E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | NA | 7.29E-08 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | NA | 6.77E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | NA | 2.06E-09 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | NA | 9.17E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | NA | 6.67E-06 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0226828976 | 1.87E-06 | NA | mr1438_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |