Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225800282:

Variant ID: vg0225800282 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25800282
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATAATAAAAATACTAATTATAAAAAATTTCATATAAGACTAAAATGAACAGTCAAACGTTGAACACGAAAATTCAGGGTTTGTCTTTTTTTAAGAC[G/A]
AAATGAGTACTAGTAAAGGGATATTTTGGTCTTCTTTAAAAAATCCCCGTGTTGTTTTCGTGGGTTTCCGATGAGGCCGGAAGGTGCCAATGTACACCAA

Reverse complement sequence

TTGGTGTACATTGGCACCTTCCGGCCTCATCGGAAACCCACGAAAACAACACGGGGATTTTTTAAAGAAGACCAAAATATCCCTTTACTAGTACTCATTT[C/T]
GTCTTAAAAAAAGACAAACCCTGAATTTTCGTGTTCAACGTTTGACTGTTCATTTTAGTCTTATATGAAATTTTTTATAATTAGTATTTTTATTATTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.50% 0.06% 0.00% NA
All Indica  2759 83.50% 16.40% 0.11% 0.00% NA
All Japonica  1512 92.90% 7.10% 0.00% 0.00% NA
Aus  269 42.80% 57.20% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 75.70% 24.30% 0.00% 0.00% NA
Indica III  913 78.50% 21.10% 0.33% 0.00% NA
Indica Intermediate  786 84.40% 15.60% 0.00% 0.00% NA
Temperate Japonica  767 89.70% 10.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225800282 G -> A LOC_Os02g42890.1 upstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:92.728; most accessible tissue: Minghui63 panicle, score: 97.714 N N N N
vg0225800282 G -> A LOC_Os02g42900.1 downstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:92.728; most accessible tissue: Minghui63 panicle, score: 97.714 N N N N
vg0225800282 G -> A LOC_Os02g42890-LOC_Os02g42900 intergenic_region ; MODIFIER silent_mutation Average:92.728; most accessible tissue: Minghui63 panicle, score: 97.714 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225800282 G A -0.05 -0.03 -0.03 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225800282 NA 1.33E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225800282 NA 8.42E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225800282 NA 2.00E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225800282 NA 4.16E-08 mr1438 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225800282 1.74E-06 1.74E-06 mr1480 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225800282 NA 6.48E-07 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251