Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225485692:

Variant ID: vg0225485692 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25485692
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAATCAGAAAAAACGAAAAAAAAACACAAAAGAAAAAATAAAGAAGAAATCGCGAAAAAAAAAGAAAAAAATGGCTGATGGGCTGGGAGGCCCGGGAG[T/C]
AGCTGGCGCGCGCGCCAACTAGCAATCCCCTGTATTGTCTACGTCGGCGTCGTTCAAGGCTGCATCAGTACATTCAACCTCTTGGATTGCTCTGGTTTGG

Reverse complement sequence

CCAAACCAGAGCAATCCAAGAGGTTGAATGTACTGATGCAGCCTTGAACGACGCCGACGTAGACAATACAGGGGATTGCTAGTTGGCGCGCGCGCCAGCT[A/G]
CTCCCGGGCCTCCCAGCCCATCAGCCATTTTTTTCTTTTTTTTTCGCGATTTCTTCTTTATTTTTTCTTTTGTGTTTTTTTTTCGTTTTTTCTGATTACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	42.50%	0.99%	0.06%	NA
All Indica	2759	82.80%	15.70%	1.38%	0.07%	NA
All Japonica	1512	5.50%	94.00%	0.46%	0.07%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	79.80%	18.70%	1.51%	0.00%	NA
Indica II	465	75.90%	23.20%	0.86%	0.00%	NA
Indica III	913	93.50%	5.50%	0.88%	0.11%	NA
Indica Intermediate	786	76.70%	21.00%	2.16%	0.13%	NA
Temperate Japonica	767	0.90%	98.60%	0.52%	0.00%	NA
Tropical Japonica	504	14.10%	85.90%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	96.30%	1.24%	0.41%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	45.60%	52.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225485692	T -> DEL	N	N	silent_mutation	Average:38.333; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0225485692	T -> C	LOC_Os02g42360.1	upstream_gene_variant ; 3737.0bp to feature; MODIFIER	silent_mutation	Average:38.333; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0225485692	T -> C	LOC_Os02g42370.1	upstream_gene_variant ; 2392.0bp to feature; MODIFIER	silent_mutation	Average:38.333; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0225485692	T -> C	LOC_Os02g42360-LOC_Os02g42370	intergenic_region ; MODIFIER	silent_mutation	Average:38.333; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225485692	NA	4.68E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	4.76E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	4.43E-08	4.43E-08	mr1855	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	3.35E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	7.10E-08	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	4.28E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	6.02E-06	6.01E-06	mr1416_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	4.04E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	7.24E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	1.86E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225485692	NA	4.02E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251