| Variant ID: vg0225412891 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 25412891 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )
AACAACGATGTTTTGTCTCTCATCTTTCTCTTTCTTCCATATCAACAAATATTTCTAATTAGCAATGCTAAGAGACCACTATTGATAACCATTGTATATG[C/T]
CCTAACAATCAACACAACATGAAACTTGGGAAACTATCTGAACTATCAAGGAAATACACACTCACTATTTTACATATCATTTACTGATTTACATGGTTAT
ATAACCATGTAAATCAGTAAATGATATGTAAAATAGTGAGTGTGTATTTCCTTGATAGTTCAGATAGTTTCCCAAGTTTCATGTTGTGTTGATTGTTAGG[G/A]
CATATACAATGGTTATCAATAGTGGTCTCTTAGCATTGCTAATTAGAAATATTTGTTGATATGGAAGAAAGAGAAAGATGAGAGACAAAACATCGTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.10% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 49.50% | 49.90% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 95.90% | 4.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.20% | 35.10% | 0.67% | 0.00% | NA |
| Indica II | 465 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 39.90% | 59.40% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 47.20% | 52.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.90% | 10.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0225412891 | C -> T | LOC_Os02g42230.1 | upstream_gene_variant ; 4523.0bp to feature; MODIFIER | silent_mutation | Average:26.75; most accessible tissue: Callus, score: 50.648 | N | N | N | N |
| vg0225412891 | C -> T | LOC_Os02g42250.1 | upstream_gene_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:26.75; most accessible tissue: Callus, score: 50.648 | N | N | N | N |
| vg0225412891 | C -> T | LOC_Os02g42270.1 | downstream_gene_variant ; 1820.0bp to feature; MODIFIER | silent_mutation | Average:26.75; most accessible tissue: Callus, score: 50.648 | N | N | N | N |
| vg0225412891 | C -> T | LOC_Os02g42250-LOC_Os02g42270 | intergenic_region ; MODIFIER | silent_mutation | Average:26.75; most accessible tissue: Callus, score: 50.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0225412891 | NA | 4.44E-09 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | 3.96E-06 | 1.40E-08 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | 6.55E-06 | 1.74E-10 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | 1.06E-06 | 3.04E-09 | mr1075 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 1.37E-08 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 8.46E-10 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 4.65E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 3.41E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 6.50E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0225412891 | NA | 2.39E-08 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/