RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0225318037:

Variant ID: vg0225318037 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25318037
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGATTGTCCATTGTGAGGTCCAAATATCGCTGATAGGGGTGGTGCGGCATAACAATCATCACTACTGCTCCCTCCGTTTCAGGTTATAAGACTTTCTA[A/G]
CATTGCCCATATTCATATAGATGTTAATGAATCTAGTCACATATAAATGTTTAGATTCATTAACATATATATATGAATATGGGCAATGCTAGAAGGTCTT

Reverse complement sequence

AAGACCTTCTAGCATTGCCCATATTCATATATATATGTTAATGAATCTAAACATTTATATGTGACTAGATTCATTAACATCTATATGAATATGGGCAATG[T/C]
TAGAAAGTCTTATAACCTGAAACGGAGGGAGCAGTAGTGATGATTGTTATGCCGCACCACCCCTATCAGCGATATTTGGACCTCACAATGGACAATCTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	27.50%	0.17%	1.04%	NA
All Indica	2759	79.50%	19.20%	0.11%	1.12%	NA
All Japonica	1512	51.40%	47.60%	0.00%	1.06%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	78.70%	20.50%	0.00%	0.84%	NA
Indica II	465	74.20%	24.90%	0.65%	0.22%	NA
Indica III	913	86.60%	11.50%	0.00%	1.86%	NA
Indica Intermediate	786	75.10%	23.90%	0.00%	1.02%	NA
Temperate Japonica	767	36.80%	63.20%	0.00%	0.00%	NA
Tropical Japonica	504	75.00%	22.80%	0.00%	2.18%	NA
Japonica Intermediate	241	48.50%	49.40%	0.00%	2.07%	NA
VI/Aromatic	96	75.00%	19.80%	5.21%	0.00%	NA
Intermediate	90	75.60%	22.20%	0.00%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225318037	A -> G	LOC_Os02g42120.1	upstream_gene_variant ; 4888.0bp to feature; MODIFIER	silent_mutation	Average:42.989; most accessible tissue: Callus, score: 79.881	N	N	N	N
vg0225318037	A -> G	LOC_Os02g42110.1	intron_variant ; MODIFIER	silent_mutation	Average:42.989; most accessible tissue: Callus, score: 79.881	N	N	N	N
vg0225318037	A -> DEL	N	N	silent_mutation	Average:42.989; most accessible tissue: Callus, score: 79.881	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225318037	NA	4.65E-06	mr1242	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225318037	NA	6.34E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225318037	4.83E-06	4.83E-06	mr1761	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225318037	NA	9.83E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0225318037:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact