Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225240541:

Variant ID: vg0225240541 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 25240541
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TTAATGTGGATGCTGTTCCTGAATTGGTCAAACAGTATCCATGGGAGTCTAACTCAATTTCATGTCTGCTATTTTTTGTCTCATCATTTGTGAGCCACCT[A/C]
GTTTCAAAAATGCCCCGTTAGATTAGAAGTCCTGTCCATTGATTGCAGATAAATGCTCCTGGTGACCTCTTAGCAAATTGTGATGTTTCTGGACTAGTAT

Reverse complement sequence

ATACTAGTCCAGAAACATCACAATTTGCTAAGAGGTCACCAGGAGCATTTATCTGCAATCAATGGACAGGACTTCTAATCTAACGGGGCATTTTTGAAAC[T/G]
AGGTGGCTCACAAATGATGAGACAAAAAATAGCAGACATGAAATTGAGTTAGACTCCCATGGATACTGTTTGACCAATTCAGGAACAGCATCCACATTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 13.80% 0.15% 0.23% NA
All Indica  2759 83.40% 16.10% 0.25% 0.33% NA
All Japonica  1512 88.40% 11.50% 0.00% 0.07% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 77.80% 21.20% 0.34% 0.67% NA
Indica II  465 77.00% 22.80% 0.00% 0.22% NA
Indica III  913 93.80% 6.10% 0.00% 0.11% NA
Indica Intermediate  786 79.30% 19.70% 0.64% 0.38% NA
Temperate Japonica  767 94.90% 5.00% 0.00% 0.13% NA
Tropical Japonica  504 80.40% 19.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0225240541 A -> DEL N N silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N
vg0225240541 A -> C LOC_Os02g41990.1 downstream_gene_variant ; 4107.0bp to feature; MODIFIER silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N
vg0225240541 A -> C LOC_Os02g42020.1 downstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N
vg0225240541 A -> C LOC_Os02g41990.2 downstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N
vg0225240541 A -> C LOC_Os02g42020.2 downstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N
vg0225240541 A -> C LOC_Os02g42000.1 intron_variant ; MODIFIER silent_mutation Average:81.296; most accessible tissue: Callus, score: 95.967 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0225240541 A C -0.01 -0.03 -0.02 0.01 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0225240541 NA 6.81E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 4.77E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 2.11E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 2.15E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 1.41E-06 1.41E-06 mr1339 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 4.47E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 2.04E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 6.41E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240541 NA 9.72E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251