Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225240510:

Variant ID: vg0225240510 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25240510
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAAGTAGAGTAGCAAATTCAGCAATCTATTAATGTGGATGCTGTTCCTGAATTGGTCAAACAGTATCCATGGGAGTCTAACTCAATTTCATGTCTGC[T/A]
ATTTTTTGTCTCATCATTTGTGAGCCACCTAGTTTCAAAAATGCCCCGTTAGATTAGAAGTCCTGTCCATTGATTGCAGATAAATGCTCCTGGTGACCTC

Reverse complement sequence

GAGGTCACCAGGAGCATTTATCTGCAATCAATGGACAGGACTTCTAATCTAACGGGGCATTTTTGAAACTAGGTGGCTCACAAATGATGAGACAAAAAAT[A/T]
GCAGACATGAAATTGAGTTAGACTCCCATGGATACTGTTTGACCAATTCAGGAACAGCATCCACATTAATAGATTGCTGAATTTGCTACTCTACTTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	21.60%	0.04%	0.00%	NA
All Indica	2759	94.80%	5.20%	0.00%	0.00%	NA
All Japonica	1512	45.20%	54.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	92.60%	7.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	7.00%	0.00%	0.00%	NA
Temperate Japonica	767	56.20%	43.70%	0.13%	0.00%	NA
Tropical Japonica	504	35.90%	63.90%	0.20%	0.00%	NA
Japonica Intermediate	241	29.50%	70.50%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225240510	T -> A	LOC_Os02g41990.1	downstream_gene_variant ; 4076.0bp to feature; MODIFIER	silent_mutation	Average:82.131; most accessible tissue: Callus, score: 95.967	N	N	N	N
vg0225240510	T -> A	LOC_Os02g42020.1	downstream_gene_variant ; 1901.0bp to feature; MODIFIER	silent_mutation	Average:82.131; most accessible tissue: Callus, score: 95.967	N	N	N	N
vg0225240510	T -> A	LOC_Os02g41990.2	downstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:82.131; most accessible tissue: Callus, score: 95.967	N	N	N	N
vg0225240510	T -> A	LOC_Os02g42020.2	downstream_gene_variant ; 1901.0bp to feature; MODIFIER	silent_mutation	Average:82.131; most accessible tissue: Callus, score: 95.967	N	N	N	N
vg0225240510	T -> A	LOC_Os02g42000.1	intron_variant ; MODIFIER	silent_mutation	Average:82.131; most accessible tissue: Callus, score: 95.967	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0225240510	T	A	-0.02	0.02	0.03	0.0	-0.01	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225240510	NA	3.63E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	8.38E-07	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	5.80E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	7.44E-07	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	3.59E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	3.04E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	6.15E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	1.39E-06	1.39E-06	mr1645	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	1.51E-06	1.51E-06	mr1647	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	6.18E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	5.39E-06	mr1748	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	8.55E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	8.55E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	2.44E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	1.83E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225240510	NA	3.90E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251