Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225238120:

Variant ID: vg0225238120 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25238120
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AATGCTGTAGGGAATCTATGGCCGCTTTGCTTGTAATGTAGTGCTAGTTTGTTTGCTCTTGACTTGACCTGTAAGCACCTGAGTATGAGCGATCTTCTCT[G/T]
ATCAGATTCTGTTTTTTAGTTTAATTCGTAAATTCATAATCAAGGCATGTTCGTCCTATGCTTTCCAATCTTCTTCAGGTTTCTTTATTCCATCCTTCAT

Reverse complement sequence

ATGAAGGATGGAATAAAGAAACCTGAAGAAGATTGGAAAGCATAGGACGAACATGCCTTGATTATGAATTTACGAATTAAACTAAAAAACAGAATCTGAT[C/A]
AGAGAAGATCGCTCATACTCAGGTGCTTACAGGTCAAGTCAAGAGCAAACAAACTAGCACTACATTACAAGCAAAGCGGCCATAGATTCCCTACAGCATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	2.20%	0.02%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	94.90%	5.00%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	95.00%	4.80%	0.20%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225238120	G -> T	LOC_Os02g42000.1	upstream_gene_variant ; 1628.0bp to feature; MODIFIER	silent_mutation	Average:61.414; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0225238120	G -> T	LOC_Os02g41990.1	downstream_gene_variant ; 1686.0bp to feature; MODIFIER	silent_mutation	Average:61.414; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0225238120	G -> T	LOC_Os02g42020.1	downstream_gene_variant ; 4291.0bp to feature; MODIFIER	silent_mutation	Average:61.414; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0225238120	G -> T	LOC_Os02g42020.2	downstream_gene_variant ; 4291.0bp to feature; MODIFIER	silent_mutation	Average:61.414; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N
vg0225238120	G -> T	LOC_Os02g41990.2	intron_variant ; MODIFIER	silent_mutation	Average:61.414; most accessible tissue: Minghui63 root, score: 74.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225238120	NA	3.72E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225238120	NA	9.51E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225238120	NA	8.24E-08	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225238120	NA	3.90E-07	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225238120	3.22E-06	3.22E-06	mr1651	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225238120	NA	8.18E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251