Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225208298:

Variant ID: vg0225208298 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25208298
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCAAGGGTGGATGCTTCCTCTTCTTTTCCTTTTTCTTCCTATGCAAATTTCTTTCAGAAATTATATCTTTTCTTTCTCTAGCAAAGGTGATCATATCCT[A/G]
TTATTATTTTTTTAAACGACCCACACACGACAGTGCGAAATTTCGTATTTGATATAACAGGAAAAAAAACAAGATTAATTACAATCCTGCGATATCGTAA

Reverse complement sequence

TTACGATATCGCAGGATTGTAATTAATCTTGTTTTTTTTCCTGTTATATCAAATACGAAATTTCGCACTGTCGTGTGTGGGTCGTTTAAAAAAATAATAA[T/C]
AGGATATGATCACCTTTGCTAGAGAAAGAAAAGATATAATTTCTGAAAGAAATTTGCATAGGAAGAAAAAGGAAAAGAAGAGGAAGCATCCACCCTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.80%	0.04%	0.00%	NA
All Indica	2759	89.40%	10.60%	0.04%	0.00%	NA
All Japonica	1512	55.00%	45.00%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	78.00%	21.90%	0.11%	0.00%	NA
Indica Intermediate	786	90.60%	9.40%	0.00%	0.00%	NA
Temperate Japonica	767	41.70%	58.30%	0.00%	0.00%	NA
Tropical Japonica	504	68.80%	31.20%	0.00%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225208298	A -> G	LOC_Os02g41954.1	upstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:43.881; most accessible tissue: Callus, score: 93.67	N	N	N	N
vg0225208298	A -> G	LOC_Os02g41961.1	upstream_gene_variant ; 3434.0bp to feature; MODIFIER	silent_mutation	Average:43.881; most accessible tissue: Callus, score: 93.67	N	N	N	N
vg0225208298	A -> G	LOC_Os02g41954.2	upstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:43.881; most accessible tissue: Callus, score: 93.67	N	N	N	N
vg0225208298	A -> G	LOC_Os02g41954-LOC_Os02g41961	intergenic_region ; MODIFIER	silent_mutation	Average:43.881; most accessible tissue: Callus, score: 93.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225208298	6.26E-06	6.26E-06	mr1356	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	3.79E-06	3.79E-06	mr1375	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	NA	8.18E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	3.44E-06	3.44E-06	mr1571	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	6.71E-07	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	NA	1.47E-06	mr1921	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	NA	4.27E-06	mr1931	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225208298	2.21E-06	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251