Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0225036220:

Variant ID: vg0225036220 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 25036220
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCGTTCCTCGAGTAGATTCACATCGACGTTTCGCTGCTCCTCCTGATCCTTGTCGGAATGCTTCTGTAATCGTGTACTCTGATGTCGTAGCTCACTGG[G/C]
GAGCATGGCCTCGGAGCCGTACACGAGGAAGAAGGGTGTTTCCTTGTTAGACGTTGTCGGTGTGGTGCGTACAGCCCATAGTACTGATGGGAGTTCTTCG

Reverse complement sequence

CGAAGAACTCCCATCAGTACTATGGGCTGTACGCACCACACCGACAACGTCTAACAAGGAAACACCCTTCTTCCTCGTGTACGGCTCCGAGGCCATGCTC[C/G]
CCAGTGAGCTACGACATCAGAGTACACGATTACAGAAGCATTCCGACAAGGATCAGGAGGAGCAGCGAAACGTCGATGTGAATCTACTCGAGGAACGAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	10.90%	0.87%	1.74%	NA
All Indica	2759	77.80%	17.80%	1.38%	2.97%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	82.00%	13.10%	3.36%	1.51%	NA
Indica II	465	83.20%	15.70%	0.43%	0.65%	NA
Indica III	913	67.40%	26.00%	0.99%	5.70%	NA
Indica Intermediate	786	83.60%	13.20%	0.89%	2.29%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	4.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	2.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0225036220	G -> DEL	N	N	silent_mutation	Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0225036220	G -> C	LOC_Os02g41690.1	downstream_gene_variant ; 1161.0bp to feature; MODIFIER	silent_mutation	Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0225036220	G -> C	LOC_Os02g41696.1	downstream_gene_variant ; 273.0bp to feature; MODIFIER	silent_mutation	Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0225036220	G -> C	LOC_Os02g41702.1	downstream_gene_variant ; 1935.0bp to feature; MODIFIER	silent_mutation	Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0225036220	G -> C	LOC_Os02g41690-LOC_Os02g41696	intergenic_region ; MODIFIER	silent_mutation	Average:35.702; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0225036220	NA	9.29E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	2.13E-07	NA	mr1686	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	1.23E-06	1.62E-07	mr1686	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	1.26E-06	mr1744	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	4.06E-10	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	2.13E-07	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	9.80E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	1.00E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0225036220	NA	5.20E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251