Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224909167:

Variant ID: vg0224909167 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24909167
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATATATATATATATATATATATAGAGCAAGGGTGAGTATTTACGTACTCAGCAAGCCAGGGGAACTTAGGTGGTTAATGCAAGCTTCAAGGGAAGGCT[G/T,A]
TTATTTTTCAATCAGTTTTATTTGCAAGCATTTTGACAATCTAAGTGTGTTCATTCCGCGACCAGAGCGAGACAAGTCTCAGCTCGGCCGAGGGTGAGGA

Reverse complement sequence

TCCTCACCCTCGGCCGAGCTGAGACTTGTCTCGCTCTGGTCGCGGAATGAACACACTTAGATTGTCAAAATGCTTGCAAATAAAACTGATTGAAAAATAA[C/A,T]
AGCCTTCCCTTGAAGCTTGCATTAACCACCTAAGTTCCCCTGGCTTGCTGAGTACGTAAATACTCACCCTTGCTCTATATATATATATATATATATATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.40%	0.20%	1.93%	2.29%	T: 0.19%
All Indica	2759	92.50%	0.20%	3.15%	3.81%	T: 0.33%
All Japonica	1512	99.80%	0.00%	0.13%	0.07%	NA
Aus	269	97.80%	1.50%	0.74%	0.00%	NA
Indica I	595	91.60%	0.00%	4.03%	4.03%	T: 0.34%
Indica II	465	92.70%	0.00%	4.09%	2.80%	T: 0.43%
Indica III	913	94.30%	0.40%	1.97%	3.29%	NA
Indica Intermediate	786	91.10%	0.10%	3.31%	4.83%	T: 0.64%
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224909167	G -> A	LOC_Os02g41530.1	upstream_gene_variant ; 624.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> A	LOC_Os02g41540.1	upstream_gene_variant ; 2344.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> A	LOC_Os02g41520.1	downstream_gene_variant ; 4105.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> A	LOC_Os02g41530-LOC_Os02g41540	intergenic_region ; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> T	LOC_Os02g41530.1	upstream_gene_variant ; 624.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> T	LOC_Os02g41540.1	upstream_gene_variant ; 2344.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> T	LOC_Os02g41520.1	downstream_gene_variant ; 4105.0bp to feature; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> T	LOC_Os02g41530-LOC_Os02g41540	intergenic_region ; MODIFIER	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N
vg0224909167	G -> DEL	N	N	silent_mutation	Average:35.739; most accessible tissue: Zhenshan97 flower, score: 71.992	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224909167	NA	1.14E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	5.58E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	4.74E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	1.58E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	8.20E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	7.91E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	1.42E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	1.97E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	1.64E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	1.56E-06	mr1233_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	3.36E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224909167	NA	2.21E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251