Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224844906:

Variant ID: vg0224844906 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 24844906
Reference Allele: TAlternative Allele: A,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGGTCTTTATTTTAAGATCACATAATACTAGTAGTATTAGGTTGATATATTTTGGAACGGAAATAAATATATATGTGTAGCAACCGTTTTATTTTTTT[T/A,TA]
AAAAAAAGTTTGACCACGACGTTGTAGCTATCGGTGCCGCCATGTTGCAGATGTATTTTATGTTTCATTTTGAAGGTTTAAATGATTATTTTATCGACAC

Reverse complement sequence

GTGTCGATAAAATAATCATTTAAACCTTCAAAATGAAACATAAAATACATCTGCAACATGGCGGCACCGATAGCTACAACGTCGTGGTCAAACTTTTTTT[A/T,TA]
AAAAAAATAAAACGGTTGCTACACATATATATTTATTTCCGTTCCAAAATATATCAACCTAATACTACTAGTATTATGTGATCTTAAAATAAAGACCGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 27.20% 2.52% 0.00% TA: 1.21%
All Indica  2759 91.70% 5.70% 0.58% 0.00% TA: 1.96%
All Japonica  1512 23.30% 70.20% 6.42% 0.00% TA: 0.07%
Aus  269 88.50% 11.20% 0.37% 0.00% NA
Indica I  595 94.10% 2.00% 0.84% 0.00% TA: 3.03%
Indica II  465 98.50% 0.90% 0.65% 0.00% NA
Indica III  913 90.50% 7.00% 0.11% 0.00% TA: 2.41%
Indica Intermediate  786 87.40% 9.90% 0.89% 0.00% TA: 1.78%
Temperate Japonica  767 32.10% 57.40% 10.56% 0.00% NA
Tropical Japonica  504 11.70% 87.50% 0.79% 0.00% NA
Japonica Intermediate  241 19.90% 74.70% 4.98% 0.00% TA: 0.41%
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 60.00% 32.20% 5.56% 0.00% TA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0224844906 T -> A LOC_Os02g41470.1 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> A LOC_Os02g41470.2 downstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> A LOC_Os02g41470.3 downstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> A LOC_Os02g41460-LOC_Os02g41470 intergenic_region ; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> TA LOC_Os02g41470.1 downstream_gene_variant ; 3267.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> TA LOC_Os02g41470.2 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> TA LOC_Os02g41470.3 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N
vg0224844906 T -> TA LOC_Os02g41460-LOC_Os02g41470 intergenic_region ; MODIFIER silent_mutation Average:57.128; most accessible tissue: Minghui63 root, score: 88.313 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0224844906 T A -0.03 -0.01 -0.01 -0.01 -0.01 0.0
vg0224844906 T TA -0.1 -0.12 -0.11 -0.02 -0.12 -0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0224844906 NA 4.28E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 9.01E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 3.33E-06 3.33E-06 mr1198 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 3.29E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 5.60E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 8.62E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 3.75E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 9.26E-06 1.29E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224844906 NA 2.33E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251