| Variant ID: vg0224678499 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 24678499 |
| Reference Allele: CCA | Alternative Allele: TCA,C |
| Primary Allele: CCA | Secondary Allele: TCA |
Inferred Ancestral Allele : CCA (evidence from allele frequency in Oryza rufipogon: CCA: 0.99, CACA: 0.01, others allele: 0.00, population size: 82. )
CACTATGTCCCACAAAAAAATGAATCTAAAACTGGATGTGACATATTATAGTACAACGAATCTGGACAAATATATCACATTCAGTACTACTCCCTCCGTC[CCA/TCA,C]
AAAAAAAGACAAACCCTAGGTTTCCGTGTCCAACTTTAACTGTCCGTCTTATATAAATTTTTTTTATAATTCGTATTTTCATTGTTGTTAGATGATAAAA
TTTTATCATCTAACAACAATGAAAATACGAATTATAAAAAAAATTTATATAAGACGGACAGTTAAAGTTGGACACGGAAACCTAGGGTTTGTCTTTTTTT[TGG/TGA,G]
GACGGAGGGAGTAGTACTGAATGTGATATATTTGTCCAGATTCGTTGTACTATAATATGTCACATCCAGTTTTAGATTCATTTTTTTGTGGGACATAGTG
| Populations | Population Size | Frequency of CCA(primary allele) | Frequency of TCA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 15.90% | 10.07% | 30.30% | C: 0.06% |
| All Indica | 2759 | 21.60% | 17.90% | 15.69% | 44.73% | C: 0.04% |
| All Japonica | 1512 | 81.40% | 15.70% | 0.33% | 2.51% | NA |
| Aus | 269 | 41.30% | 0.40% | 12.64% | 45.72% | NA |
| Indica I | 595 | 9.40% | 14.60% | 23.53% | 52.44% | NA |
| Indica II | 465 | 16.30% | 10.30% | 4.73% | 68.60% | NA |
| Indica III | 913 | 28.10% | 23.00% | 20.04% | 28.81% | NA |
| Indica Intermediate | 786 | 26.30% | 19.10% | 11.20% | 43.26% | C: 0.13% |
| Temperate Japonica | 767 | 93.60% | 5.70% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 62.30% | 34.10% | 0.79% | 2.78% | NA |
| Japonica Intermediate | 241 | 82.60% | 9.10% | 0.00% | 8.30% | NA |
| VI/Aromatic | 96 | 72.90% | 4.20% | 3.12% | 19.79% | NA |
| Intermediate | 90 | 62.20% | 14.40% | 1.11% | 20.00% | C: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224678499 | CCA -> TCA | LOC_Os02g40700.1 | downstream_gene_variant ; 1135.0bp to feature; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> TCA | LOC_Os02g40700-LOC_Os02g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> DEL | N | N | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> C | LOC_Os02g40700.1 | downstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0224678499 | CCA -> C | LOC_Os02g40700-LOC_Os02g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:64.199; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224678499 | NA | 1.99E-08 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.66E-09 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 8.96E-08 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.02E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 4.97E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 3.25E-07 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.44E-06 | 1.84E-08 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 1.31E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | 2.43E-06 | NA | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224678499 | NA | 5.85E-06 | mr1146 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/