Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224640322:

Variant ID: vg0224640322 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 24640322
Reference Allele: C	Alternative Allele: A,T,CT,CTT,CTTTT
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGAAAGAAAGAAGTGCGACCATTAATTTTGACAATGTGAACCTTTGCAAAAACTAATTTTACAAATGAACCGTCCGCCAAAACTTATTTCAAAAGTGAC[C/A,T,CT,CTT,CTTTT]
CTTTTTTCAGCGCCAAATCGTGTGGCGCTGAACTTAGACACCTCAGCGCCACATCACCTGGCGCTGAATGCCGTGCCACCGTAGATGGAAGGCTGAGTCA

Reverse complement sequence

TGACTCAGCCTTCCATCTACGGTGGCACGGCATTCAGCGCCAGGTGATGTGGCGCTGAGGTGTCTAAGTTCAGCGCCACACGATTTGGCGCTGAAAAAAG[G/T,A,AG,AAG,AAAAG]
GTCACTTTTGAAATAAGTTTTGGCGGACGGTTCATTTGTAAAATTAGTTTTTGCAAAGGTTCACATTGTCAAAATTAATGGTCGCACTTCTTTCTTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.00%	9.30%	0.68%	1.54%	CT: 6.88%; CTT: 0.47%; T: 0.08%; CTTTT: 0.02%
All Indica	2759	84.20%	11.60%	0.51%	1.96%	CT: 1.45%; CTT: 0.14%; T: 0.11%
All Japonica	1512	79.20%	0.10%	0.66%	0.99%	CT: 17.92%; CTT: 0.99%; CTTTT: 0.07%; T: 0.07%
Aus	269	53.50%	41.30%	1.49%	1.12%	CT: 2.23%; CTT: 0.37%
Indica I	595	98.30%	0.20%	0.34%	0.34%	CT: 0.50%; T: 0.17%; CTT: 0.17%
Indica II	465	61.10%	30.50%	1.29%	6.45%	T: 0.43%; CT: 0.22%
Indica III	913	93.20%	5.30%	0.11%	0.55%	CT: 0.88%
Indica Intermediate	786	76.70%	16.50%	0.64%	2.16%	CT: 3.56%; CTT: 0.38%
Temperate Japonica	767	80.20%	0.10%	0.39%	0.26%	CT: 17.60%; CTT: 1.43%
Tropical Japonica	504	81.30%	0.20%	0.99%	1.19%	CT: 15.08%; CTT: 0.79%; T: 0.20%; CTTTT: 0.20%
Japonica Intermediate	241	71.40%	0.00%	0.83%	2.90%	CT: 24.90%
VI/Aromatic	96	94.80%	1.00%	3.12%	0.00%	CTT: 1.04%
Intermediate	90	83.30%	4.40%	1.11%	1.11%	CT: 8.89%; CTT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224640322	C -> A	LOC_Os02g40630.1	upstream_gene_variant ; 4323.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> A	LOC_Os02g40650.1	upstream_gene_variant ; 3071.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> A	LOC_Os02g40640.1	downstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> A	LOC_Os02g40630-LOC_Os02g40640	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> DEL	N	N	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTT	LOC_Os02g40630.1	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTT	LOC_Os02g40650.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTT	LOC_Os02g40640.1	downstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTT	LOC_Os02g40630-LOC_Os02g40640	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTTTT	LOC_Os02g40630.1	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTTTT	LOC_Os02g40650.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTTTT	LOC_Os02g40640.1	downstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CTTTT	LOC_Os02g40630-LOC_Os02g40640	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CT	LOC_Os02g40630.1	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CT	LOC_Os02g40650.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CT	LOC_Os02g40640.1	downstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> CT	LOC_Os02g40630-LOC_Os02g40640	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> T	LOC_Os02g40630.1	upstream_gene_variant ; 4323.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> T	LOC_Os02g40650.1	upstream_gene_variant ; 3071.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> T	LOC_Os02g40640.1	downstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg0224640322	C -> T	LOC_Os02g40630-LOC_Os02g40640	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224640322	NA	8.15E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	4.46E-06	NA	mr1589	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	7.61E-06	6.21E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	NA	1.41E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	5.85E-06	NA	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	9.26E-06	3.28E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	4.39E-07	2.83E-08	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	9.61E-06	3.07E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	NA	6.85E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224640322	3.04E-06	4.15E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251