Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224508452:

Variant ID: vg0224508452 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24508452
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATGTTTCACCTAGTGTATTTATAATGGTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAACGCACATATTTT[G/A]
GAAACTCTCTATTAAGGAAATTTGGTTTATTTTTTTCCATAAAAAATATTTTACCTAGTGTACTCACAATGTTTTACTATGTATAGATCTAATGTTGCAG

Reverse complement sequence

CTGCAACATTAGATCTATACATAGTAAAACATTGTGAGTACACTAGGTAAAATATTTTTTATGGAAAAAAATAAACCAAATTTCCTTAATAGAGAGTTTC[C/T]
AAAATATGTGCGTTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAACCATTATAAATACACTAGGTGAAACATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	8.60%	0.21%	1.65%	NA
All Indica	2759	89.50%	9.70%	0.11%	0.69%	NA
All Japonica	1512	92.30%	4.00%	0.07%	3.70%	NA
Aus	269	70.60%	27.10%	1.86%	0.37%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	83.20%	16.10%	0.00%	0.65%	NA
Indica III	913	91.70%	7.80%	0.00%	0.55%	NA
Indica Intermediate	786	85.10%	13.10%	0.38%	1.40%	NA
Temperate Japonica	767	95.80%	2.20%	0.00%	1.96%	NA
Tropical Japonica	504	88.90%	5.60%	0.00%	5.56%	NA
Japonica Intermediate	241	88.00%	6.20%	0.41%	5.39%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	3.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224508452	G -> A	LOC_Os02g40430-LOC_Os02g40440	intergenic_region ; MODIFIER	silent_mutation	Average:79.09; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg0224508452	G -> DEL	N	N	silent_mutation	Average:79.09; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224508452	NA	5.64E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508452	NA	7.75E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224508452	2.53E-06	NA	mr1589	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251