Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224459356:

Variant ID: vg0224459356 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24459356
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TCCATAAGTCGCTTGAAAGTTGATATTCCACTCTTTAAGTTGTTTTGTTATAAATGTCAATCCACATACTCGGTTTGGTTACAAAAACTATCCCAATGCA[C/T]
ATGTGCTTAACCGAATCAATATGTTTTCGTATATTTGTGAAACATCAATGTGATCTGTACCAAAACTAAAAATACTTCTAGAAGTATAATTTTGACACTT

Reverse complement sequence

AAGTGTCAAAATTATACTTCTAGAAGTATTTTTAGTTTTGGTACAGATCACATTGATGTTTCACAAATATACGAAAACATATTGATTCGGTTAAGCACAT[G/A]
TGCATTGGGATAGTTTTTGTAACCAAACCGAGTATGTGGATTGACATTTATAACAAAACAACTTAAAGAGTGGAATATCAACTTTCAAGCGACTTATGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	34.50%	0.74%	18.60%	NA
All Indica	2759	45.00%	39.30%	0.43%	15.30%	NA
All Japonica	1512	44.50%	27.20%	1.26%	26.98%	NA
Aus	269	68.40%	19.00%	0.74%	11.90%	NA
Indica I	595	39.20%	24.20%	0.67%	35.97%	NA
Indica II	465	67.70%	28.60%	0.00%	3.66%	NA
Indica III	913	30.40%	55.30%	0.44%	13.80%	NA
Indica Intermediate	786	52.80%	38.40%	0.51%	8.27%	NA
Temperate Japonica	767	37.70%	27.00%	1.83%	33.51%	NA
Tropical Japonica	504	56.90%	31.20%	0.60%	11.31%	NA
Japonica Intermediate	241	40.20%	19.90%	0.83%	39.00%	NA
VI/Aromatic	96	41.70%	54.20%	1.04%	3.12%	NA
Intermediate	90	50.00%	33.30%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224459356	C -> T	LOC_Os02g40390.1	upstream_gene_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:22.341; most accessible tissue: Callus, score: 49.293	N	N	N	N
vg0224459356	C -> T	LOC_Os02g40400.1	downstream_gene_variant ; 2892.0bp to feature; MODIFIER	silent_mutation	Average:22.341; most accessible tissue: Callus, score: 49.293	N	N	N	N
vg0224459356	C -> T	LOC_Os02g40390-LOC_Os02g40400	intergenic_region ; MODIFIER	silent_mutation	Average:22.341; most accessible tissue: Callus, score: 49.293	N	N	N	N
vg0224459356	C -> DEL	N	N	silent_mutation	Average:22.341; most accessible tissue: Callus, score: 49.293	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224459356	NA	4.69E-06	mr1047_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224459356	3.14E-06	1.36E-06	mr1189_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251