Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0224267593:

Variant ID: vg0224267593 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 24267593
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGGAAGGGAGTGACCTCGCCGCCGTCCCTCTCTTCTCCACCGTTACCGAGTTGGGCGGTTTTATGCGACCTCACGGCCGTCTCCGATGTCAGCTGCC[C/T]
TGTTTCCGGTCGTTCCTGAGCCACCCCCAACCCCACTCCACCTCCTTGCTGCCATGGTTGCGATGGCAGCCGCCACCACCACATCGCATCTCCTAACCAT

Reverse complement sequence

ATGGTTAGGAGATGCGATGTGGTGGTGGCGGCTGCCATCGCAACCATGGCAGCAAGGAGGTGGAGTGGGGTTGGGGGTGGCTCAGGAACGACCGGAAACA[G/A]
GGCAGCTGACATCGGAGACGGCCGTGAGGTCGCATAAAACCGCCCAACTCGGTAACGGTGGAGAAGAGAGGGACGGCGGCGAGGTCACTCCCTTCCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	20.90%	0.49%	0.00%	NA
All Indica	2759	72.60%	27.10%	0.33%	0.00%	NA
All Japonica	1512	86.00%	13.20%	0.86%	0.00%	NA
Aus	269	95.50%	4.10%	0.37%	0.00%	NA
Indica I	595	60.30%	39.70%	0.00%	0.00%	NA
Indica II	465	80.90%	18.50%	0.65%	0.00%	NA
Indica III	913	73.60%	26.30%	0.11%	0.00%	NA
Indica Intermediate	786	75.80%	23.50%	0.64%	0.00%	NA
Temperate Japonica	767	83.80%	15.80%	0.39%	0.00%	NA
Tropical Japonica	504	91.50%	6.50%	1.98%	0.00%	NA
Japonica Intermediate	241	81.30%	18.70%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0224267593	C -> T	LOC_Os02g40080.1	upstream_gene_variant ; 558.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40070.1	downstream_gene_variant ; 1296.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40090.1	downstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40090.4	downstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40090.5	downstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40090.3	downstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N
vg0224267593	C -> T	LOC_Os02g40070-LOC_Os02g40080	intergenic_region ; MODIFIER	silent_mutation	Average:82.534; most accessible tissue: Zhenshan97 flag leaf, score: 91.601	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0224267593	C	T	-0.01	-0.01	-0.01	-0.02	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0224267593	7.04E-06	7.04E-06	mr1015	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	1.56E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	1.43E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	3.04E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	1.89E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	8.60E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	3.00E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	8.65E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	5.33E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	1.13E-07	1.13E-07	mr1412	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	2.21E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	6.43E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	1.04E-06	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	2.75E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	9.42E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	5.92E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	7.22E-07	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0224267593	NA	8.29E-06	mr1913_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251