| Variant ID: vg0224159749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 24159749 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.00, others allele: 0.00, population size: 327. )
TAAGTTGCCATAAGCATAACGTCATTGCAACTAATAATCACCAATGCTTAGATATGAACATTTTGGTTAATGAGTGCCACTGGTATGGTATGACATTAAC[T/C,G]
TTATATGCTGCTCTATTGTTTTATTGAATGAAGGCAGAAGTAACTTGATGAATTTGCTGAAACTGCTTGCCATGACAGGTACATCTTTTTTGTGACATTG
CAATGTCACAAAAAAGATGTACCTGTCATGGCAAGCAGTTTCAGCAAATTCATCAAGTTACTTCTGCCTTCATTCAATAAAACAATAGAGCAGCATATAA[A/G,C]
GTTAATGTCATACCATACCAGTGGCACTCATTAACCAAAATGTTCATATCTAAGCATTGGTGATTATTAGTTGCAATGACGTTATGCTTATGGCAACTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 3.20% | 0.04% | 0.00% | G: 0.04% |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.50% | 8.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 3.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.30% | 30.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 0.00% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0224159749 | T -> G | LOC_Os02g39940.1 | upstream_gene_variant ; 3299.0bp to feature; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| vg0224159749 | T -> G | LOC_Os02g39960.1 | downstream_gene_variant ; 3804.0bp to feature; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| vg0224159749 | T -> G | LOC_Os02g39950.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| vg0224159749 | T -> C | LOC_Os02g39940.1 | upstream_gene_variant ; 3299.0bp to feature; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| vg0224159749 | T -> C | LOC_Os02g39960.1 | downstream_gene_variant ; 3804.0bp to feature; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| vg0224159749 | T -> C | LOC_Os02g39950.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.548; most accessible tissue: Zhenshan97 flower, score: 81.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0224159749 | 3.56E-07 | 6.35E-06 | mr1101 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 2.79E-06 | 3.25E-07 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 4.59E-07 | 1.03E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | NA | 5.76E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 1.76E-06 | 3.60E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | NA | 5.02E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 1.91E-06 | 2.45E-07 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 7.06E-06 | 1.69E-08 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | 1.20E-06 | 1.01E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0224159749 | NA | 5.84E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/