Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223811992:

Variant ID: vg0223811992 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23811992
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, A: 0.34, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCAGCCCATCAAGTCGATGGCCTTGTACCCTGTCAGCTCCGCGAGATCCTGGCTCCATGGCTCATGCCCCAGCACGTCCAGCCTCGCCAGGAAGATCG[A/C]
CGACGCCGCCACAATGGACGGCAGGTAGCGGTGGAACCCGTACGTCAGCAGCGACCCGTCGGCGAACCGATGCGCCGCCTCCTTCAACAGCTCCTCTTCT

Reverse complement sequence

AGAAGAGGAGCTGTTGAAGGAGGCGGCGCATCGGTTCGCCGACGGGTCGCTGCTGACGTACGGGTTCCACCGCTACCTGCCGTCCATTGTGGCGGCGTCG[T/G]
CGATCTTCCTGGCGAGGCTGGACGTGCTGGGGCATGAGCCATGGAGCCAGGATCTCGCGGAGCTGACAGGGTACAAGGCCATCGACTTGATGGGCTGCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 27.10% 1.38% 11.66% NA
All Indica  2759 45.30% 39.80% 1.63% 13.23% NA
All Japonica  1512 94.60% 4.40% 0.13% 0.86% NA
Aus  269 27.10% 22.70% 3.72% 46.47% NA
Indica I  595 50.40% 49.20% 0.17% 0.17% NA
Indica II  465 35.70% 24.30% 3.66% 36.34% NA
Indica III  913 41.90% 50.20% 0.88% 7.01% NA
Indica Intermediate  786 51.10% 29.80% 2.42% 16.67% NA
Temperate Japonica  767 93.40% 6.50% 0.13% 0.00% NA
Tropical Japonica  504 96.80% 1.20% 0.00% 1.98% NA
Japonica Intermediate  241 93.80% 4.60% 0.41% 1.24% NA
VI/Aromatic  96 17.70% 33.30% 5.21% 43.75% NA
Intermediate  90 65.60% 24.40% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223811992 A -> DEL LOC_Os02g39470.1 N frameshift_variant Average:29.151; most accessible tissue: Zhenshan97 flower, score: 50.724 N N N N
vg0223811992 A -> C LOC_Os02g39470.1 missense_variant ; p.Ser802Ala; MODERATE nonsynonymous_codon ; S802A Average:29.151; most accessible tissue: Zhenshan97 flower, score: 50.724 benign -0.229 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223811992 2.29E-08 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.24E-06 4.21E-10 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.13E-10 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.96E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.16E-06 NA mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.79E-06 2.22E-09 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.55E-06 NA mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.81E-10 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.80E-06 NA mr1095 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.84E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.09E-07 NA mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.42E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 8.37E-06 NA mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 5.59E-06 NA mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 5.81E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.23E-06 NA mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 3.33E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.20E-08 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 5.32E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.94E-07 NA mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.50E-07 1.45E-09 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.00E-08 NA mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.24E-07 3.34E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.07E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.45E-09 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.93E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.08E-08 NA mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 5.81E-08 5.78E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 7.97E-06 NA mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.49E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.21E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 6.74E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.71E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.64E-09 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 3.99E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.02E-06 NA mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 6.22E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.38E-07 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 8.06E-07 1.34E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.86E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.46E-06 NA mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.92E-10 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 9.53E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.11E-06 4.69E-13 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.50E-11 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.18E-13 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.11E-08 NA mr1095_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.45E-07 4.18E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.21E-08 NA mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.17E-07 2.75E-08 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.68E-08 NA mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.46E-08 6.96E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 5.26E-11 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.15E-12 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.74E-07 NA mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.50E-06 2.51E-09 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 6.05E-08 3.63E-09 mr1183_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.34E-06 NA mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 1.01E-06 4.17E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 2.68E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 6.22E-13 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 1.49E-09 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 5.79E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 4.70E-07 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 NA 6.47E-12 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 2.87E-06 NA mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 3.82E-06 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 5.61E-06 NA mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 7.13E-06 NA mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.00E-07 5.64E-08 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223811992 4.07E-06 7.63E-12 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251