Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223668140:

Variant ID: vg0223668140 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23668140
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

CGCCTATGCCTCTACCGCACTTCATCCTGCCAGAAAACCCTAACCCTAGTGCCGCCGACCAGTTGCGTATGGATCGGCGACCAGCCGCACGCGTGTCACG[C/T]
CCAGAAATTCACGAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGAACCAGCCAGGGTACACAAACGACAATTGTTGACATACAGATCC

Reverse complement sequence

GGATCTGTATGTCAACAATTGTCGTTTGTGTACCCTGGCTGGTTCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTCGTGAATTTCTGG[G/A]
CGTGACACGCGTGCGGCTGGTCGCCGATCCATACGCAACTGGTCGGCGGCACTAGGGTTAGGGTTTTCTGGCAGGATGAAGTGCGGTAGAGGCATAGGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	18.50%	0.06%	0.21%	NA
All Indica	2759	72.20%	27.40%	0.11%	0.29%	NA
All Japonica	1512	98.20%	1.70%	0.00%	0.07%	NA
Aus	269	83.30%	16.70%	0.00%	0.00%	NA
Indica I	595	71.90%	28.10%	0.00%	0.00%	NA
Indica II	465	85.20%	14.40%	0.22%	0.22%	NA
Indica III	913	58.90%	40.50%	0.22%	0.33%	NA
Indica Intermediate	786	80.00%	19.50%	0.00%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.00%	0.41%	NA
VI/Aromatic	96	66.70%	33.30%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223668140	C -> T	LOC_Os02g39170.1	upstream_gene_variant ; 3681.0bp to feature; MODIFIER	silent_mutation	Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0223668140	C -> T	LOC_Os02g39180.1	downstream_gene_variant ; 977.0bp to feature; MODIFIER	silent_mutation	Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0223668140	C -> T	LOC_Os02g39180-LOC_Os02g39190	intergenic_region ; MODIFIER	silent_mutation	Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0223668140	C -> DEL	N	N	silent_mutation	Average:73.316; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223668140	NA	8.68E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	NA	4.44E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	NA	6.31E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	7.43E-07	1.40E-07	mr1063_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	1.13E-06	NA	mr1161_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	4.22E-06	NA	mr1183_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223668140	2.32E-06	3.67E-07	mr1183_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251