Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223638971:

Variant ID: vg0223638971 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23638971
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACTCCGCCGTTGGCCGCACGAGCGTGCGCACGAGGAAGAGAGAGTAGGGTGACCGGGGAGGCGTTAGATTGAGGGAGAAGTATGACAAGTGGGCCCA[C/T]
GGAGTTTTTTTAAAACTTTTTTGCTGACTGGACTGACACGTTGGCATCTCGTAGGTAAGCTCAAGTCAAAACCGCTAAGAACAATATTTAGGTGGTTATT

Reverse complement sequence

AATAACCACCTAAATATTGTTCTTAGCGGTTTTGACTTGAGCTTACCTACGAGATGCCAACGTGTCAGTCCAGTCAGCAAAAAAGTTTTAAAAAAACTCC[G/A]
TGGGCCCACTTGTCATACTTCTCCCTCAATCTAACGCCTCCCCGGTCACCCTACTCTCTCTTCCTCGTGCGCACGCTCGTGCGGCCAACGGCGGAGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	25.90%	0.70%	0.00%	NA
All Indica	2759	76.20%	23.30%	0.54%	0.00%	NA
All Japonica	1512	68.40%	30.60%	1.06%	0.00%	NA
Aus	269	66.90%	32.70%	0.37%	0.00%	NA
Indica I	595	67.40%	31.40%	1.18%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	75.50%	24.30%	0.22%	0.00%	NA
Indica Intermediate	786	73.30%	26.00%	0.76%	0.00%	NA
Temperate Japonica	767	89.00%	9.40%	1.56%	0.00%	NA
Tropical Japonica	504	48.80%	51.00%	0.20%	0.00%	NA
Japonica Intermediate	241	43.60%	55.20%	1.24%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223638971	C -> T	LOC_Os02g39130.1	upstream_gene_variant ; 3283.0bp to feature; MODIFIER	silent_mutation	Average:63.798; most accessible tissue: Callus, score: 87.421	N	N	N	N
vg0223638971	C -> T	LOC_Os02g39140.1	upstream_gene_variant ; 4121.0bp to feature; MODIFIER	silent_mutation	Average:63.798; most accessible tissue: Callus, score: 87.421	N	N	N	N
vg0223638971	C -> T	LOC_Os02g39140.2	upstream_gene_variant ; 4121.0bp to feature; MODIFIER	silent_mutation	Average:63.798; most accessible tissue: Callus, score: 87.421	N	N	N	N
vg0223638971	C -> T	LOC_Os02g39130-LOC_Os02g39140	intergenic_region ; MODIFIER	silent_mutation	Average:63.798; most accessible tissue: Callus, score: 87.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223638971	8.20E-06	8.19E-06	mr1340	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	4.51E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	5.11E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	1.67E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	2.73E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	2.87E-07	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	1.06E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	8.64E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	1.14E-06	1.14E-06	mr1906_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	7.48E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223638971	NA	1.58E-07	mr1960_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251