Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223525077:

Variant ID: vg0223525077 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23525077
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGAGTTGATTTGTGCTGGTTTTGAAAGATGGGGGAGGCGTTATTGTCGGTTTTGCGGTTGAGGGATGCGGTTCATTCAATAGGAAGAAATGAAGGAGA[G/A]
AAAATAGACTTATTCCCTACTTGCAGCATCTCATTGGAGGTCCAGTACGTAAGGCCCACTACCCACCACGTCCACACACTGCAGGCCTTAAGGCCCAGTA

Reverse complement sequence

TACTGGGCCTTAAGGCCTGCAGTGTGTGGACGTGGTGGGTAGTGGGCCTTACGTACTGGACCTCCAATGAGATGCTGCAAGTAGGGAATAAGTCTATTTT[C/T]
TCTCCTTCATTTCTTCCTATTGAATGAACCGCATCCCTCAACCGCAAAACCGACAATAACGCCTCCCCCATCTTTCAAAACCAGCACAAATCAACTCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.50% 0.97% 0.06% NA
All Indica  2759 91.20% 8.60% 0.14% 0.00% NA
All Japonica  1512 91.60% 7.40% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.70% 11.10% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 87.20% 12.60% 0.22% 0.00% NA
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 1.80% 0.26% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 63.90% 30.70% 5.39% 0.00% NA
VI/Aromatic  96 74.00% 0.00% 22.92% 3.12% NA
Intermediate  90 88.90% 5.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223525077 G -> A LOC_Os02g38910.1 upstream_gene_variant ; 4526.0bp to feature; MODIFIER silent_mutation Average:99.199; most accessible tissue: Zhenshan97 young leaf, score: 99.549 N N N N
vg0223525077 G -> A LOC_Os02g38920.1 upstream_gene_variant ; 2441.0bp to feature; MODIFIER silent_mutation Average:99.199; most accessible tissue: Zhenshan97 young leaf, score: 99.549 N N N N
vg0223525077 G -> A LOC_Os02g38910-LOC_Os02g38920 intergenic_region ; MODIFIER silent_mutation Average:99.199; most accessible tissue: Zhenshan97 young leaf, score: 99.549 N N N N
vg0223525077 G -> DEL N N silent_mutation Average:99.199; most accessible tissue: Zhenshan97 young leaf, score: 99.549 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223525077 G A 0.0 0.01 0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223525077 NA 2.48E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 2.47E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 7.85E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 8.26E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 5.23E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 1.34E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 6.53E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 4.70E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 3.45E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 7.72E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 1.51E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 5.34E-07 5.34E-07 mr1192_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 1.45E-06 1.45E-06 mr1192_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 8.92E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 9.42E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 5.94E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 8.01E-06 8.55E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 7.62E-06 4.30E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 9.90E-06 6.54E-07 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 5.30E-07 5.30E-07 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 1.81E-06 1.81E-06 mr1311_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 9.13E-08 8.32E-09 mr1312_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 3.05E-07 3.05E-07 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 4.13E-06 1.77E-06 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 5.32E-06 3.31E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 6.39E-06 6.39E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 8.18E-06 7.74E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.80E-06 5.21E-07 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.00E-06 2.00E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 5.33E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 5.30E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 5.12E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 4.03E-07 2.35E-07 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 5.26E-06 5.26E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 8.74E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 8.83E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 3.64E-08 3.64E-08 mr1634_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 3.21E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 1.35E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 3.20E-07 1.55E-07 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 9.91E-07 9.91E-07 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 4.65E-06 4.48E-07 mr1665_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 6.30E-06 1.63E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 8.96E-07 8.96E-07 mr1697_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 4.42E-06 4.42E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 8.05E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 7.77E-06 7.76E-06 mr1766_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 6.39E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 NA 1.97E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.06E-06 9.84E-08 mr1816_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 9.01E-06 9.01E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.83E-06 2.61E-07 mr1832_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 1.18E-06 9.70E-08 mr1833_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.62E-06 3.55E-07 mr1843_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 1.25E-07 1.25E-07 mr1847_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 5.33E-06 3.83E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 4.90E-07 4.90E-07 mr1979_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223525077 2.78E-06 2.78E-06 mr1979_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251