Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223511164:

Variant ID: vg0223511164 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23511164
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, G: 0.28, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGTGCAAGATTTTGTCACGCTGTGGAAAGAAAATGAGAAAGTTGACATTGTTGATTCACTGAGAGGTGTGTTATTGTAGTATTCGTGCGTGTATTTT[T/G]
GTCCACTCTTAAGAATGATTCTTGATCCATGCATATACTTTTTTTTCTTTTTTTTTTAACCTTGATGGAAGGAACGTTGAATGATTTGTTGGTTTTTGCG

Reverse complement sequence

CGCAAAAACCAACAAATCATTCAACGTTCCTTCCATCAAGGTTAAAAAAAAAAGAAAAAAAAGTATATGCATGGATCAAGAATCATTCTTAAGAGTGGAC[A/C]
AAAATACACGCACGAATACTACAATAACACACCTCTCAGTGAATCAACAATGTCAACTTTCTCATTTTCTTTCCACAGCGTGACAAAATCTTGCACACCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	43.10%	0.11%	0.00%	NA
All Indica	2759	68.10%	31.80%	0.14%	0.00%	NA
All Japonica	1512	29.00%	71.00%	0.00%	0.00%	NA
Aus	269	98.10%	1.50%	0.37%	0.00%	NA
Indica I	595	50.10%	49.90%	0.00%	0.00%	NA
Indica II	465	61.30%	38.50%	0.22%	0.00%	NA
Indica III	913	84.30%	15.70%	0.00%	0.00%	NA
Indica Intermediate	786	66.90%	32.70%	0.38%	0.00%	NA
Temperate Japonica	767	19.60%	80.40%	0.00%	0.00%	NA
Tropical Japonica	504	44.20%	55.80%	0.00%	0.00%	NA
Japonica Intermediate	241	27.00%	73.00%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223511164	T -> G	LOC_Os02g38880.1	upstream_gene_variant ; 2114.0bp to feature; MODIFIER	silent_mutation	Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595	N	N	N	N
vg0223511164	T -> G	LOC_Os02g38890.1	upstream_gene_variant ; 1988.0bp to feature; MODIFIER	silent_mutation	Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595	N	N	N	N
vg0223511164	T -> G	LOC_Os02g38870.1	downstream_gene_variant ; 3445.0bp to feature; MODIFIER	silent_mutation	Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595	N	N	N	N
vg0223511164	T -> G	LOC_Os02g38900.1	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595	N	N	N	N
vg0223511164	T -> G	LOC_Os02g38880-LOC_Os02g38890	intergenic_region ; MODIFIER	silent_mutation	Average:65.458; most accessible tissue: Minghui63 flower, score: 84.595	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223511164	1.70E-06	1.70E-06	mr1555	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164	NA	1.89E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164	NA	4.96E-06	mr1882	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164	NA	3.90E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223511164	NA	3.50E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251