Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223433169:

Variant ID: vg0223433169 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23433169
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.24, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCCTAAGGATCACAATTCACAACTTCCCAACCAATATAAAAATTTCTGCACCCTCGTCACCAAGGATAAAACCCAATGTGAACTAATGTGAAGGAAA[G/A]
TCGAGATATAGAACTTCATTAGAGCGTAAATAGTATCCTTTGGTTCCAGACATCAACACATGCCCTTTTAGCTGGTCGCATATATCTTCCGTGCTGCTCT

Reverse complement sequence

AGAGCAGCACGGAAGATATATGCGACCAGCTAAAAGGGCATGTGTTGATGTCTGGAACCAAAGGATACTATTTACGCTCTAATGAAGTTCTATATCTCGA[C/T]
TTTCCTTCACATTAGTTCACATTGGGTTTTATCCTTGGTGACGAGGGTGCAGAAATTTTTATATTGGTTGGGAAGTTGTGAATTGTGATCCTTAGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.40%	24.90%	0.89%	39.80%	NA
All Indica	2759	55.50%	2.40%	0.80%	41.32%	NA
All Japonica	1512	3.60%	70.40%	0.93%	25.13%	NA
Aus	269	2.60%	1.10%	0.74%	95.54%	NA
Indica I	595	68.60%	2.50%	0.67%	28.24%	NA
Indica II	465	66.70%	1.70%	0.65%	30.97%	NA
Indica III	913	36.50%	1.90%	0.99%	60.68%	NA
Indica Intermediate	786	61.10%	3.30%	0.76%	34.86%	NA
Temperate Japonica	767	2.60%	79.50%	0.26%	17.60%	NA
Tropical Japonica	504	6.20%	55.60%	1.59%	36.71%	NA
Japonica Intermediate	241	1.20%	72.20%	1.66%	24.90%	NA
VI/Aromatic	96	13.50%	10.40%	0.00%	76.04%	NA
Intermediate	90	24.40%	36.70%	4.44%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223433169	G -> A	LOC_Os02g38780.1	intron_variant ; MODIFIER	silent_mutation	Average:48.975; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg0223433169	G -> A	LOC_Os02g38780.2	intron_variant ; MODIFIER	silent_mutation	Average:48.975; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg0223433169	G -> A	LOC_Os02g38780.3	intron_variant ; MODIFIER	silent_mutation	Average:48.975; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg0223433169	G -> DEL	N	N	silent_mutation	Average:48.975; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223433169	NA	4.53E-06	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223433169	NA	3.31E-26	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223433169	4.57E-06	4.57E-06	mr1797	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223433169	4.57E-06	4.57E-06	mr1801	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223433169	NA	2.94E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223433169	NA	5.53E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251