Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222801968:

Variant ID: vg0222801968 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22801968
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCATTTAACTTTTCTATGGACCCTTTGTATATTACTAAATCCGGTTTGAATGAATTTGTATGTACTGAACTTAGATGGACTATTTATGTAAGCTTTGCA[A/G]
ACTTGAATTTTGATGTATGGATTGTGATTGATGTTCATATATTTATCCAAATCGCCATGTGTATTTTTTTTTTGGGCGTGGAACTCATTTTTTCTGACGG

Reverse complement sequence

CCGTCAGAAAAAATGAGTTCCACGCCCAAAAAAAAAATACACATGGCGATTTGGATAAATATATGAACATCAATCACAATCCATACATCAAAATTCAAGT[T/C]
TGCAAAGCTTACATAAATAGTCCATCTAAGTTCAGTACATACAAATTCATTCAAACCGGATTTAGTAATATACAAAGGGTCCATAGAAAAGTTAAATGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.20%	0.20%	1.29%	41.30%	NA
All Indica	2759	38.00%	0.20%	1.81%	60.02%	NA
All Japonica	1512	98.10%	0.10%	0.13%	1.59%	NA
Aus	269	5.90%	0.40%	1.86%	91.82%	NA
Indica I	595	28.90%	0.00%	1.34%	69.75%	NA
Indica II	465	40.20%	0.00%	0.22%	59.57%	NA
Indica III	913	39.80%	0.10%	2.85%	57.28%	NA
Indica Intermediate	786	41.50%	0.50%	1.91%	56.11%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	95.60%	0.40%	0.20%	3.77%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	76.70%	1.10%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222801968	A -> G	LOC_Os02g37790.1	upstream_gene_variant ; 3113.0bp to feature; MODIFIER	silent_mutation	Average:9.009; most accessible tissue: Callus, score: 46.884	N	N	N	N
vg0222801968	A -> G	LOC_Os02g37800.1	downstream_gene_variant ; 3677.0bp to feature; MODIFIER	silent_mutation	Average:9.009; most accessible tissue: Callus, score: 46.884	N	N	N	N
vg0222801968	A -> G	LOC_Os02g37790-LOC_Os02g37800	intergenic_region ; MODIFIER	silent_mutation	Average:9.009; most accessible tissue: Callus, score: 46.884	N	N	N	N
vg0222801968	A -> DEL	N	N	silent_mutation	Average:9.009; most accessible tissue: Callus, score: 46.884	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222801968	NA	6.83E-06	mr1099	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	5.47E-06	mr1101	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	9.03E-06	NA	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	1.22E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	5.99E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	6.32E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	8.50E-06	mr1858	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	7.07E-06	mr1859	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	4.69E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	3.23E-06	4.57E-07	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	2.37E-06	mr1913	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	4.79E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	3.81E-06	NA	mr1929	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	9.07E-06	NA	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	7.96E-06	1.81E-07	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	9.21E-06	NA	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	4.40E-06	NA	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968	NA	2.54E-07	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251