Variant ID: vg0222799084 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22799084 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTATAATCCGATGTGACCAATCTTCCGCCCTCGATGTGCCTCTGCTCTGCACGATCTCGTCGGCCTGGCTTGGTCCACCCATACGCGCGCACTTTGTCAC[A/G]
AGCCTCTGCACAACAAGCCTATTGAGCCCCTTGTACCACGTCTGACCAATGTCCTGCCGAGCCGCCCAAAAAATCGCTGCCGCTTTGTTGCTTTGGTTCG
CGAACCAAAGCAACAAAGCGGCAGCGATTTTTTGGGCGGCTCGGCAGGACATTGGTCAGACGTGGTACAAGGGGCTCAATAGGCTTGTTGTGCAGAGGCT[T/C]
GTGACAAAGTGCGCGCGTATGGGTGGACCAAGCCAGGCCGACGAGATCGTGCAGAGCAGAGGCACATCGAGGGCGGAAGATTGGTCACATCGGATTATAG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 57.70% | 0.40% | 11.96% | 29.92% | NA |
All Indica | 2759 | 38.60% | 0.40% | 16.06% | 44.98% | NA |
All Japonica | 1512 | 98.20% | 0.00% | 0.00% | 1.79% | NA |
Aus | 269 | 7.80% | 2.20% | 41.64% | 48.33% | NA |
Indica I | 595 | 30.10% | 0.00% | 6.05% | 63.87% | NA |
Indica II | 465 | 40.40% | 0.00% | 12.90% | 46.67% | NA |
Indica III | 913 | 39.80% | 1.00% | 27.05% | 32.20% | NA |
Indica Intermediate | 786 | 42.50% | 0.30% | 12.72% | 44.53% | NA |
Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
Tropical Japonica | 504 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
VI/Aromatic | 96 | 90.60% | 1.00% | 5.21% | 3.12% | NA |
Intermediate | 90 | 80.00% | 0.00% | 5.56% | 14.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222799084 | A -> G | LOC_Os02g37790.1 | upstream_gene_variant ; 229.0bp to feature; MODIFIER | silent_mutation | Average:9.692; most accessible tissue: Callus, score: 33.336 | N | N | N | N |
vg0222799084 | A -> G | LOC_Os02g37790-LOC_Os02g37800 | intergenic_region ; MODIFIER | silent_mutation | Average:9.692; most accessible tissue: Callus, score: 33.336 | N | N | N | N |
vg0222799084 | A -> DEL | N | N | silent_mutation | Average:9.692; most accessible tissue: Callus, score: 33.336 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222799084 | 6.12E-06 | NA | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | NA | 7.10E-06 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | NA | 7.50E-10 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | 4.15E-07 | NA | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | 3.24E-06 | 1.37E-07 | mr1225 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | NA | 7.72E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | 1.84E-06 | NA | mr1868 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | NA | 3.42E-06 | mr1868 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | 1.01E-06 | NA | mr1918 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | 3.89E-06 | 4.49E-08 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222799084 | NA | 9.39E-06 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |