| Variant ID: vg0222730246 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22730246 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, T: 0.44, others allele: 0.00, population size: 108. )
ACAGTTGTACACCTCTGATCAGAGTAAAACTATTCGAATAGCCGTGCCTGCGGTTATGGGCGGTCGACCAGATTCACCGTGATTAGTCTCACACTTAATA[T/A]
ATCGACCCAATGCACTGTAGTTCAGGTGGGTTGGTTGGGCCTATTCAACGTGGTGTAGCGTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACA
TGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAACGCTACACCACGTTGAATAGGCCCAACCAACCCACCTGAACTACAGTGCATTGGGTCGAT[A/T]
TATTAAGTGTGAGACTAATCACGGTGAATCTGGTCGACCGCCCATAACCGCAGGCACGGCTATTCGAATAGTTTTACTCTGATCAGAGGTGTACAACTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 42.00% | 2.24% | 1.78% | NA |
| All Indica | 2759 | 33.00% | 60.30% | 3.66% | 3.04% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.20% | 78.70% | 2.18% | 0.00% | NA |
| Indica II | 465 | 45.20% | 40.20% | 8.82% | 5.81% | NA |
| Indica III | 913 | 32.70% | 61.70% | 2.30% | 3.29% | NA |
| Indica Intermediate | 786 | 36.50% | 56.70% | 3.31% | 3.44% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 22.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222730246 | T -> A | LOC_Os02g37654.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.382; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0222730246 | T -> DEL | N | N | silent_mutation | Average:42.382; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222730246 | NA | 2.01E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 1.73E-12 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 2.14E-11 | 9.97E-21 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 3.13E-25 | 3.58E-51 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 1.65E-20 | 1.12E-36 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | NA | 5.37E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 4.99E-21 | 1.14E-59 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 3.95E-19 | 1.81E-35 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 8.09E-20 | 4.64E-58 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730246 | 2.42E-21 | 1.45E-29 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/