| Variant ID: vg0222531687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22531687 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 61. )
CGCACGGCGTCTATGTGATAAGTTGTGCTTAGTGCGTATTGTAATTAAACCTTACTCCCTCTGTCTCTAAATATTTAACGCTATTGATTTTTTTAAATAT[A/G]
TTTGACCGTTTATCTTAATAAAAAACTTTTCTGTAATATAAAAAACTATATATATATACATAAGGAAAAAGAACGAATTACCCCCCTAAACAATCATGAC
GTCATGATTGTTTAGGGGGGTAATTCGTTCTTTTTCCTTATGTATATATATATAGTTTTTTATATTACAGAAAAGTTTTTTATTAAGATAAACGGTCAAA[T/C]
ATATTTAAAAAAATCAATAGCGTTAAATATTTAGAGACAGAGGGAGTAAGGTTTAATTACAATACGCACTAAGCACAACTTATCACATAGACGCCGTGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 0.30% | 0.42% | 58.63% | NA |
| All Indica | 2759 | 12.30% | 0.10% | 0.47% | 87.10% | NA |
| All Japonica | 1512 | 95.20% | 0.50% | 0.33% | 3.90% | NA |
| Aus | 269 | 1.10% | 0.00% | 0.37% | 98.51% | NA |
| Indica I | 595 | 22.40% | 0.00% | 0.34% | 77.31% | NA |
| Indica II | 465 | 4.50% | 0.00% | 0.00% | 95.48% | NA |
| Indica III | 913 | 10.40% | 0.20% | 0.55% | 88.83% | NA |
| Indica Intermediate | 786 | 11.60% | 0.10% | 0.76% | 87.53% | NA |
| Temperate Japonica | 767 | 97.70% | 0.90% | 0.65% | 0.78% | NA |
| Tropical Japonica | 504 | 90.10% | 0.00% | 0.00% | 9.92% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 1.11% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222531687 | A -> G | LOC_Os02g37260.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:46.835; most accessible tissue: Callus, score: 73.766 | N | N | N | N |
| vg0222531687 | A -> G | LOC_Os02g37260-LOC_Os02g37270 | intergenic_region ; MODIFIER | silent_mutation | Average:46.835; most accessible tissue: Callus, score: 73.766 | N | N | N | N |
| vg0222531687 | A -> DEL | N | N | silent_mutation | Average:46.835; most accessible tissue: Callus, score: 73.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222531687 | NA | 1.18E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | NA | 1.26E-31 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 5.11E-06 | 4.32E-34 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | NA | 4.64E-20 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 4.20E-06 | NA | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | NA | 6.16E-06 | mr1095 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 3.86E-07 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 1.58E-07 | NA | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 2.74E-07 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222531687 | 4.71E-06 | NA | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/