Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222522726:

Variant ID: vg0222522726 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 22522726
Reference Allele: CGATA	Alternative Allele: AGATA,C
Primary Allele: CGATA	Secondary Allele: AGATA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTAGGAAGTTTAATGGACTTTTAATATATAATAGATAATAGAAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT[CGATA/AGATA,C]
CAACAGATCTGAACGGATAGGTAAACTATATGCAGTAATGATGCAGCTGCTCACGAGAGTCCTCGGCGGAGGCGACGTCGATGAAAGCAGCGGCGAGCAG

Reverse complement sequence

CTGCTCGCCGCTGCTTTCATCGACGTCGCCTCCGCCGAGGACTCTCGTGAGCAGCTGCATCATTACTGCATATAGTTTACCTATCCGTTCAGATCTGTTG[TATCG/TATCT,G]
ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTTCTATTATCTATTATATATTAAAAGTCCATTAAACTTCCTACAA

Allele Frequencies:

Populations	Population Size	Frequency of CGATA(primary allele)	Frequency of AGATA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	4.60%	6.05%	57.53%	C: 0.08%
All Indica	2759	8.60%	0.10%	6.02%	85.28%	NA
All Japonica	1512	76.30%	12.80%	6.48%	4.37%	C: 0.07%
Aus	269	3.00%	0.00%	1.49%	95.54%	NA
Indica I	595	22.00%	0.00%	6.55%	71.43%	NA
Indica II	465	3.00%	0.20%	4.30%	92.47%	NA
Indica III	913	2.70%	0.00%	6.13%	91.13%	NA
Indica Intermediate	786	8.40%	0.40%	6.49%	84.73%	NA
Temperate Japonica	767	64.00%	23.70%	10.56%	1.69%	NA
Tropical Japonica	504	87.90%	0.60%	1.98%	9.52%	NA
Japonica Intermediate	241	90.90%	3.70%	2.90%	2.07%	C: 0.41%
VI/Aromatic	96	60.40%	12.50%	13.54%	11.46%	C: 2.08%
Intermediate	90	47.80%	10.00%	5.56%	35.56%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222522726	CGATA -> DEL	N	N	silent_mutation	Average:40.884; most accessible tissue: Callus, score: 78.763	N	N	N	N
vg0222522726	CGATA -> AGATA	LOC_Os02g37254-LOC_Os02g37260	intergenic_region ; MODIFIER	silent_mutation	Average:40.884; most accessible tissue: Callus, score: 78.763	N	N	N	N
vg0222522726	CGATA -> C	LOC_Os02g37254-LOC_Os02g37260	intergenic_region ; MODIFIER	silent_mutation	Average:40.884; most accessible tissue: Callus, score: 78.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222522726	1.03E-06	NA	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	1.17E-06	NA	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	NA	1.78E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	6.96E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	1.76E-06	1.76E-06	mr1609_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	5.85E-07	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222522726	5.00E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251