Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222266766:

Variant ID: vg0222266766 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22266766
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, A: 0.27, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAACCTTGTCTTTCATGTTTGGAAATCCGAAGTTTAAGATGAGCCAAGACATAATTCCTTGAGATGCACATGCGGCTGTGCGTGAATCGGTTTACA[T/A]
GGGGTGGTCCTGCAACAAATGGACACGGAACCCCAGTGGCCAGTGTTCCTGGCTAAACTTCCTATACCATCAGATGCAGGTGCAGAACTGCAGATAGACA

Reverse complement sequence

TGTCTATCTGCAGTTCTGCACCTGCATCTGATGGTATAGGAAGTTTAGCCAGGAACACTGGCCACTGGGGTTCCGTGTCCATTTGTTGCAGGACCACCCC[A/T]
TGTAAACCGATTCACGCACAGCCGCATGTGCATCTCAAGGAATTATGTCTTGGCTCATCTTAAACTTCGGATTTCCAAACATGAAAGACAAGGTTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 22.70% 0.25% 0.02% NA
All Indica  2759 67.80% 31.80% 0.40% 0.04% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 39.00% 60.60% 0.37% 0.00% NA
Indica I  595 74.60% 25.20% 0.17% 0.00% NA
Indica II  465 80.60% 19.10% 0.22% 0.00% NA
Indica III  913 54.80% 44.50% 0.77% 0.00% NA
Indica Intermediate  786 70.20% 29.40% 0.25% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222266766 T -> A LOC_Os02g36890.1 upstream_gene_variant ; 1154.0bp to feature; MODIFIER silent_mutation Average:62.269; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0222266766 T -> A LOC_Os02g36880-LOC_Os02g36890 intergenic_region ; MODIFIER silent_mutation Average:62.269; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0222266766 T -> DEL N N silent_mutation Average:62.269; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222266766 T A -0.04 -0.03 -0.04 0.01 -0.05 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222266766 NA 9.96E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 2.67E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 9.79E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 8.87E-07 NA mr1101 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 8.62E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 5.32E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 5.80E-07 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 4.99E-07 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 2.73E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222266766 NA 8.11E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251