RiceVarMap2

Detailed information for vg0222029032:

Variant ID: vg0222029032 (JBrowse)

Variation Type: SNP

Chromosome: chr02

Position: 22029032

Reference Allele: C

Alternative Allele: T

Primary Allele: T

Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGCCGGGAAGCAAGTTGGGAGTCCACATCCTATAAAAAACATCATGACTACAACAAGACCACTCGAGCTTCTTCATATGGATTTATTTGGGCCCGTGG[C/T]
CTACGTAAGCATTGGAGGTAATAAGTATGGTTTTGTTATTGTTGATGATTTTTCACGCTTCACTTGGGTGTACTTTCTCCATGACAAAAGCAAAGCTCAA

Reverse complement sequence

TTGAGCTTTGCTTTTGTCATGGAGAAAGTACACCCAAGTGAAGCGTGAAAAATCATCAACAATAACAAAACCATACTTATTACCTCCAATGCTTACGTAG[G/A]
CCACGGGCCCAAATAAATCCATATGAAGAAGCTCGAGTGGTCTTGTTGTAGTCATGATGTTTTTTATAGGATGTGGACTCCCAACTTGCTTCCCGGCTTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	36.60%	0.13%	0.00%	NA
All Indica	2759	92.30%	7.50%	0.22%	0.00%	NA
All Japonica	1512	8.10%	91.90%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	95.10%	4.50%	0.34%	0.00%	NA
Indica II	465	98.30%	1.30%	0.43%	0.00%	NA
Indica III	913	91.20%	8.70%	0.11%	0.00%	NA
Indica Intermediate	786	87.80%	12.10%	0.13%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	19.80%	80.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222029032	C -> T	LOC_Os02g36470.1	missense_variant ; p.Ala869Val; MODERATE	nonsynonymous_codon ; A869V	Average:8.967; most accessible tissue: Callus, score: 28.057	benign	0.593	TOLERATED	0.12

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222029032	4.28E-06	1.01E-11	Awn_length	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222029032	NA	1.45E-39	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222029032	NA	4.18E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222029032	NA	2.89E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0222029032:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact