Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222021204:

Variant ID: vg0222021204 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22021204
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAAACGCGAATATTAGAGAATGATCTAATATCAAATAATTAGAAGGAGTGAGGCTTCGAACACAGGTCTTCTAGCCCACCACCTTGTGGAGCTAGC[C/T]
GGAAGACCTATGGGTGTTTCTCTCAACCCTTCTACTAGGGGAAGCAGCCGGTGTTGTCGAAGACGCAGGACTCAGTTTTACGGTTACGGCTGAAATTTGG

Reverse complement sequence

CCAAATTTCAGCCGTAACCGTAAAACTGAGTCCTGCGTCTTCGACAACACCGGCTGCTTCCCCTAGTAGAAGGGTTGAGAGAAACACCCATAGGTCTTCC[G/A]
GCTAGCTCCACAAGGTGGTGGGCTAGAAGACCTGTGTTCGAAGCCTCACTCCTTCTAATTATTTGATATTAGATCATTCTCTAATATTCGCGTTTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 5.60% 0.97% 0.00% NA
All Indica  2759 89.20% 9.20% 1.63% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 0.30% 2.69% 0.00% NA
Indica II  465 73.30% 23.20% 3.44% 0.00% NA
Indica III  913 94.20% 5.50% 0.33% 0.00% NA
Indica Intermediate  786 86.90% 11.80% 1.27% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222021204 C -> T LOC_Os02g36470.1 upstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:87.351; most accessible tissue: Callus, score: 94.519 N N N N
vg0222021204 C -> T LOC_Os02g36450.1 downstream_gene_variant ; 3557.0bp to feature; MODIFIER silent_mutation Average:87.351; most accessible tissue: Callus, score: 94.519 N N N N
vg0222021204 C -> T LOC_Os02g36460.1 downstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:87.351; most accessible tissue: Callus, score: 94.519 N N N N
vg0222021204 C -> T LOC_Os02g36450.2 downstream_gene_variant ; 3559.0bp to feature; MODIFIER silent_mutation Average:87.351; most accessible tissue: Callus, score: 94.519 N N N N
vg0222021204 C -> T LOC_Os02g36460-LOC_Os02g36470 intergenic_region ; MODIFIER silent_mutation Average:87.351; most accessible tissue: Callus, score: 94.519 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222021204 C T 0.03 0.0 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222021204 NA 6.81E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 6.14E-08 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 6.61E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 1.19E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 1.04E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 8.32E-06 NA mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 9.17E-06 7.93E-09 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 2.74E-07 mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 2.20E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 4.27E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 6.03E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 5.42E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 6.33E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 3.20E-08 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 1.95E-06 1.95E-06 mr1591 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 2.08E-06 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 3.34E-06 6.86E-07 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 7.57E-06 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 5.05E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 4.18E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 5.83E-06 1.08E-11 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 1.01E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222021204 NA 3.55E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251