Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222017648:

Variant ID: vg0222017648 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22017648
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCCCGCGCAATTGCGTGGCTAACACCTAAACAAAACATATATTTTTTACTATGATTTTACTTAAAATTTATTAAATAGTTATGTCATTGTCTTAAGA[T/C]
TTTGAAAGACCAAACCTTATCATTTCTGTGTTTCTAATTATATAGTTTTTAAAAGTCACACCAGCTACTACCCCTTATGTCATCTCCTTCTTTATTTACT

Reverse complement sequence

AGTAAATAAAGAAGGAGATGACATAAGGGGTAGTAGCTGGTGTGACTTTTAAAAACTATATAATTAGAAACACAGAAATGATAAGGTTTGGTCTTTCAAA[A/G]
TCTTAAGACAATGACATAACTATTTAATAAATTTTAAGTAAAATCATAGTAAAAAATATATGTTTTGTTTAGGTGTTAGCCACGCAATTGCGCGGGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.60%	31.10%	24.25%	7.09%	NA
All Indica	2759	9.10%	42.40%	37.69%	10.87%	NA
All Japonica	1512	92.00%	6.20%	1.59%	0.26%	NA
Aus	269	3.30%	64.70%	22.30%	9.67%	NA
Indica I	595	4.50%	45.50%	34.12%	15.80%	NA
Indica II	465	3.40%	30.30%	52.90%	13.33%	NA
Indica III	913	10.60%	51.00%	30.67%	7.67%	NA
Indica Intermediate	786	14.00%	37.00%	39.57%	9.41%	NA
Temperate Japonica	767	98.80%	0.70%	0.39%	0.13%	NA
Tropical Japonica	504	80.20%	15.70%	3.57%	0.60%	NA
Japonica Intermediate	241	95.00%	3.70%	1.24%	0.00%	NA
VI/Aromatic	96	87.50%	10.40%	2.08%	0.00%	NA
Intermediate	90	46.70%	25.60%	22.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222017648	T -> DEL	N	N	silent_mutation	Average:58.913; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0222017648	T -> C	LOC_Os02g36460.1	upstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:58.913; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0222017648	T -> C	LOC_Os02g36450.1	downstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:58.913; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0222017648	T -> C	LOC_Os02g36450.2	downstream_gene_variant ; 3.0bp to feature; MODIFIER	silent_mutation	Average:58.913; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0222017648	T -> C	LOC_Os02g36450-LOC_Os02g36460	intergenic_region ; MODIFIER	silent_mutation	Average:58.913; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222017648	NA	2.50E-07	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222017648	1.60E-06	1.06E-07	mr1212	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648	NA	1.89E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648	NA	1.55E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648	NA	1.96E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222017648	NA	3.68E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251