Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222002361:

Variant ID: vg0222002361 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22002361
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.33, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TGACACGTACGTACGTTGTGTTAGCTAATGCTGATGGGCTCGTGATGTCGGGCACTGCATGCATGGTGCGGTGGTGTGGAGTGTGGACTCGATATCCATC[G/A]
GCATCGCCGTTGTTGGGGTTAGCCACACGGGCAACTGGGCAAACCGGGGCGATGGACATGGATGATCGAACAAGTCGACTAGTTCTGTCTTGTGTAACGC

Reverse complement sequence

GCGTTACACAAGACAGAACTAGTCGACTTGTTCGATCATCCATGTCCATCGCCCCGGTTTGCCCAGTTGCCCGTGTGGCTAACCCCAACAACGGCGATGC[C/T]
GATGGATATCGAGTCCACACTCCACACCACCGCACCATGCATGCAGTGCCCGACATCACGAGCCCATCAGCATTAGCTAACACAACGTACGTACGTGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 38.30% 0.15% 0.00% NA
All Indica  2759 91.70% 8.20% 0.07% 0.00% NA
All Japonica  1512 8.90% 90.90% 0.20% 0.00% NA
Aus  269 70.30% 29.70% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 12.20% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 98.80% 0.13% 0.00% NA
Tropical Japonica  504 22.80% 76.80% 0.40% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222002361 G -> A LOC_Os02g36414.1 3_prime_UTR_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:81.679; most accessible tissue: Zhenshan97 root, score: 94.146 N N N N
vg0222002361 G -> A LOC_Os02g36430.1 downstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:81.679; most accessible tissue: Zhenshan97 root, score: 94.146 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222002361 G A 0.12 0.08 0.02 0.02 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222002361 NA 1.22E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222002361 NA 4.48E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 NA 9.23E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 NA 3.74E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 NA 2.88E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 4.92E-06 5.78E-07 mr1404 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 NA 4.76E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222002361 NA 8.79E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251