| Variant ID: vg0221902760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 21902760 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )
ATTGAGGTAGAATAAAACTTAAATTAATGTTGGAAGACACCTCTACTGTACATGCACACCCCTAATTTAATCCTAGTTGTTGAAGAACAGGAACAGGAAT[C/T]
CCTAATTATTTGTCTTATTCAGCTTGCAAGATTTTTACTAGCTACAACTTAGCACATGTAGCATCAGAATAAGCATGCAATAGTTTTTCACCATAACTTT
AAAGTTATGGTGAAAAACTATTGCATGCTTATTCTGATGCTACATGTGCTAAGTTGTAGCTAGTAAAAATCTTGCAAGCTGAATAAGACAAATAATTAGG[G/A]
ATTCCTGTTCCTGTTCTTCAACAACTAGGATTAAATTAGGGGTGTGCATGTACAGTAGAGGTGTCTTCCAACATTAATTTAAGTTTTATTCTACCTCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.70% | 5.10% | 7.38% | 8.82% | NA |
| All Indica | 2759 | 80.70% | 8.40% | 7.90% | 3.04% | NA |
| All Japonica | 1512 | 72.60% | 0.30% | 6.08% | 21.10% | NA |
| Aus | 269 | 96.30% | 0.70% | 2.23% | 0.74% | NA |
| Indica I | 595 | 75.60% | 2.20% | 18.66% | 3.53% | NA |
| Indica II | 465 | 88.20% | 4.30% | 4.09% | 3.44% | NA |
| Indica III | 913 | 79.10% | 15.60% | 3.07% | 2.30% | NA |
| Indica Intermediate | 786 | 81.90% | 7.10% | 7.63% | 3.31% | NA |
| Temperate Japonica | 767 | 66.60% | 0.00% | 2.35% | 31.03% | NA |
| Tropical Japonica | 504 | 84.70% | 0.80% | 6.94% | 7.54% | NA |
| Japonica Intermediate | 241 | 66.00% | 0.00% | 16.18% | 17.84% | NA |
| VI/Aromatic | 96 | 62.50% | 0.00% | 29.17% | 8.33% | NA |
| Intermediate | 90 | 86.70% | 3.30% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221902760 | C -> T | LOC_Os02g36264.1 | upstream_gene_variant ; 3530.0bp to feature; MODIFIER | silent_mutation | Average:50.977; most accessible tissue: Callus, score: 74.552 | N | N | N | N |
| vg0221902760 | C -> T | LOC_Os02g36280.1 | downstream_gene_variant ; 1594.0bp to feature; MODIFIER | silent_mutation | Average:50.977; most accessible tissue: Callus, score: 74.552 | N | N | N | N |
| vg0221902760 | C -> T | LOC_Os02g36264-LOC_Os02g36280 | intergenic_region ; MODIFIER | silent_mutation | Average:50.977; most accessible tissue: Callus, score: 74.552 | N | N | N | N |
| vg0221902760 | C -> DEL | N | N | silent_mutation | Average:50.977; most accessible tissue: Callus, score: 74.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0221902760 | NA | 1.24E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | NA | 2.37E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | 5.11E-06 | 4.30E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | 2.39E-08 | 2.39E-08 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | NA | 1.80E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | NA | 6.58E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | NA | 3.25E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0221902760 | NA | 7.13E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |