Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221870781:

Variant ID: vg0221870781 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21870781
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCCTCTGTATTTTAATACATGATGCTGTCGATTTTTTTTATCAATATTTAACTATTCATTTTATTTATAAAAATATGCAATTATCATTTATTTTATGT[G/A]
ACTTTATCATCAAATGTTTTTTAAACATAACATAAATATTTTAATATTTGTATAAAACTTTTGAAAAAGACGAATGGTCAAACATTGGTCAAAAAGTGAC

Reverse complement sequence

GTCACTTTTTGACCAATGTTTGACCATTCGTCTTTTTCAAAAGTTTTATACAAATATTAAAATATTTATGTTATGTTTAAAAAACATTTGATGATAAAGT[C/T]
ACATAAAATAAATGATAATTGCATATTTTTATAAATAAAATGAATAGTTAAATATTGATAAAAAAAATCGACAGCATCATGTATTAAAATACAGAGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	24.80%	0.72%	0.02%	NA
All Indica	2759	97.90%	1.30%	0.76%	0.04%	NA
All Japonica	1512	32.90%	66.90%	0.20%	0.00%	NA
Aus	269	97.80%	0.40%	1.86%	0.00%	NA
Indica I	595	98.80%	0.20%	1.01%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.40%	1.40%	0.22%	0.00%	NA
Indica Intermediate	786	95.90%	2.30%	1.65%	0.13%	NA
Temperate Japonica	767	47.80%	51.90%	0.26%	0.00%	NA
Tropical Japonica	504	20.40%	79.40%	0.20%	0.00%	NA
Japonica Intermediate	241	11.60%	88.40%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	90.60%	1.04%	0.00%	NA
Intermediate	90	55.60%	40.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221870781	G -> A	LOC_Os02g36230.1	downstream_gene_variant ; 1201.0bp to feature; MODIFIER	silent_mutation	Average:27.241; most accessible tissue: Callus, score: 48.728	N	N	N	N
vg0221870781	G -> A	LOC_Os02g36230-LOC_Os02g36250	intergenic_region ; MODIFIER	silent_mutation	Average:27.241; most accessible tissue: Callus, score: 48.728	N	N	N	N
vg0221870781	G -> DEL	N	N	silent_mutation	Average:27.241; most accessible tissue: Callus, score: 48.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221870781	2.19E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	5.05E-06	6.65E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	1.05E-06	2.11E-07	mr1502	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	3.03E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	2.62E-06	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	NA	4.61E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	NA	9.92E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	NA	4.65E-09	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	1.52E-07	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221870781	5.65E-06	NA	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251