Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0221342297:

Variant ID: vg0221342297 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21342297
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCCATCTGGTCTGCCGCTTCCACACCACACTGCCCTTCGAGAACTGGTCCTATATCTCATCATACTGTATAATCTGTCTCAACGCCGAGCGCAACGAC[G/A]
ACAAGTCGACAATAGCCCTCACAGCTCGTCGCCCTCCCATTCCTCGCACATGCCCGGCTGATCTGGTGATCTTCACCATCTAGCCCTGTTGCCGTGTCGA

Reverse complement sequence

TCGACACGGCAACAGGGCTAGATGGTGAAGATCACCAGATCAGCCGGGCATGTGCGAGGAATGGGAGGGCGACGAGCTGTGAGGGCTATTGTCGACTTGT[C/T]
GTCGTTGCGCTCGGCGTTGAGACAGATTATACAGTATGATGAGATATAGGACCAGTTCTCGAAGGGCAGTGTGGTGTGGAAGCGGCAGACCAGATGGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	5.10%	0.51%	0.42%	NA
All Indica	2759	89.70%	8.70%	0.83%	0.72%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.80%	4.70%	0.34%	0.17%	NA
Indica II	465	91.60%	8.00%	0.22%	0.22%	NA
Indica III	913	86.30%	10.80%	1.31%	1.53%	NA
Indica Intermediate	786	88.80%	9.70%	1.02%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221342297	G -> A	LOC_Os02g35500.1	upstream_gene_variant ; 1965.0bp to feature; MODIFIER	silent_mutation	Average:28.977; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221342297	G -> A	LOC_Os02g35490-LOC_Os02g35500	intergenic_region ; MODIFIER	silent_mutation	Average:28.977; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0221342297	G -> DEL	N	N	silent_mutation	Average:28.977; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221342297	NA	4.48E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	2.87E-09	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	8.27E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	5.88E-06	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	1.74E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	7.84E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	3.72E-06	mr1784_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	1.70E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	4.37E-06	1.70E-09	mr1800_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	4.36E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	1.27E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	6.09E-07	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	2.29E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	9.96E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221342297	NA	4.86E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251