RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0221234344:

Variant ID: vg0221234344 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 21234344
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACGTTGTTAACTTTTTGACAATCATTTGACCATTCGCCTTATCAAAATTTTTGTACAAATATTAAAAATATTTTAGTCATGCTTAAAGAACATTTGAT[A/G]
ATAAATTAAGTCAAAATAAAATAAATGATAATTACATATATTTTTTTGAATAAGAAGAATGGTCAAATGTATCTCAAAAAGTCAGCGACGCCATATATTA

Reverse complement sequence

TAATATATGGCGTCGCTGACTTTTTGAGATACATTTGACCATTCTTCTTATTCAAAAAAATATATGTAATTATCATTTATTTTATTTTGACTTAATTTAT[T/C]
ATCAAATGTTCTTTAAGCATGACTAAAATATTTTTAATATTTGTACAAAAATTTTGATAAGGCGAATGGTCAAATGATTGTCAAAAAGTTAACAACGTCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.90%	0.13%	0.00%	NA
All Indica	2759	98.80%	1.10%	0.11%	0.00%	NA
All Japonica	1512	6.30%	93.50%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.40%	0.13%	0.00%	NA
Temperate Japonica	767	8.90%	90.70%	0.39%	0.00%	NA
Tropical Japonica	504	2.40%	97.60%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0221234344	A -> G	LOC_Os02g35310.1	upstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:42.832; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0221234344	A -> G	LOC_Os02g35315.1	downstream_gene_variant ; 207.0bp to feature; MODIFIER	silent_mutation	Average:42.832; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0221234344	A -> G	LOC_Os02g35315.2	downstream_gene_variant ; 207.0bp to feature; MODIFIER	silent_mutation	Average:42.832; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N
vg0221234344	A -> G	LOC_Os02g35310-LOC_Os02g35315	intergenic_region ; MODIFIER	silent_mutation	Average:42.832; most accessible tissue: Minghui63 root, score: 61.65	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0221234344	1.27E-06	NA	mr1101	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	3.15E-36	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	2.71E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	4.40E-84	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	1.28E-50	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	1.94E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	2.16E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	1.92E-48	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	1.60E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0221234344	NA	3.65E-43	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 36 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0221234344:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact